Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Kif16b'

567291

Institutional Source

Beutler Lab

Gene Symbol

Kif16b

Ensembl Gene

ENSMUSG00000038844

Gene Name

kinesin family member 16B

Synonyms

8430434E15Rik, N-3 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142617474-142901531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 142712931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 649 (R649Q)

Ref Sequence

ENSEMBL: ENSMUSP00000042551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]

AlphaFold

B1AVY7

Predicted Effect

probably benign
Transcript: ENSMUST00000043589
AA Change: R649Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: R649Q

Domain	Start	End	E-Value	Type
KISc	1	366	4.87e-173	SMART
FHA	477	529	1.43e-1	SMART
coiled coil region	597	809	N/A	INTRINSIC
coiled coil region	835	858	N/A	INTRINSIC
coiled coil region	941	1022	N/A	INTRINSIC
PX	1179	1281	1.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211861
AA Change: R649Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000230763
AA Change: R660Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Kif16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kif16b	APN	2	142848035	nonsense	probably null
IGL00499:Kif16b	APN	2	142857324	missense	probably damaging	1.00
IGL00913:Kif16b	APN	2	142704007	nonsense	probably null
IGL00971:Kif16b	APN	2	142711744	missense	probably benign	0.01
IGL01712:Kif16b	APN	2	142648471	missense	probably damaging	1.00
IGL01965:Kif16b	APN	2	142848405	missense	probably damaging	1.00
IGL02428:Kif16b	APN	2	142672360	missense	possibly damaging	0.88
IGL02576:Kif16b	APN	2	142862545	splice site	probably benign
IGL02884:Kif16b	APN	2	142702614	splice site	probably benign
IGL03065:Kif16b	APN	2	142619913	missense	probably damaging	1.00
IGL03103:Kif16b	APN	2	142862488	missense	probably damaging	1.00
IGL03403:Kif16b	APN	2	142711869	missense	probably damaging	1.00
IGL02835:Kif16b	UTSW	2	142712213	missense	probably benign	0.00
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0081:Kif16b	UTSW	2	142707426	splice site	probably benign
R0123:Kif16b	UTSW	2	142672375	missense	probably benign
R0134:Kif16b	UTSW	2	142672375	missense	probably benign
R0388:Kif16b	UTSW	2	142740937	missense	probably damaging	1.00
R0396:Kif16b	UTSW	2	142853659	missense	probably damaging	1.00
R0502:Kif16b	UTSW	2	142712155	missense	probably benign	0.00
R1027:Kif16b	UTSW	2	142854538	splice site	probably benign
R1674:Kif16b	UTSW	2	142712953	nonsense	probably null
R1752:Kif16b	UTSW	2	142690666	missense	probably benign	0.01
R2154:Kif16b	UTSW	2	142690580	missense	probably damaging	1.00
R2262:Kif16b	UTSW	2	142740917	missense	probably damaging	1.00
R2401:Kif16b	UTSW	2	142756122	missense	probably benign	0.04
R3951:Kif16b	UTSW	2	142707359	missense	probably benign	0.01
R4161:Kif16b	UTSW	2	142707404	missense	probably benign	0.00
R4697:Kif16b	UTSW	2	142690694	missense	probably benign	0.09
R4747:Kif16b	UTSW	2	142857426	missense	probably damaging	1.00
R4808:Kif16b	UTSW	2	142857358	missense	probably damaging	1.00
R4878:Kif16b	UTSW	2	142848003	missense	probably damaging	1.00
R5068:Kif16b	UTSW	2	142711707	missense	probably benign
R5120:Kif16b	UTSW	2	142848339	missense	probably damaging	1.00
R5358:Kif16b	UTSW	2	142740969	missense	probably damaging	1.00
R5821:Kif16b	UTSW	2	142702666	missense	probably damaging	1.00
R5833:Kif16b	UTSW	2	142707367	missense	probably benign
R5882:Kif16b	UTSW	2	142707258	critical splice donor site	probably null
R5974:Kif16b	UTSW	2	142857381	missense	probably damaging	1.00
R6043:Kif16b	UTSW	2	142711900	missense	probably damaging	1.00
R6230:Kif16b	UTSW	2	142849912	missense	probably damaging	1.00
R6373:Kif16b	UTSW	2	142699698	missense	possibly damaging	0.91
R6472:Kif16b	UTSW	2	142699948	intron	probably benign
R6622:Kif16b	UTSW	2	142712442	missense	probably benign	0.01
R6654:Kif16b	UTSW	2	142701277	intron	probably benign
R6912:Kif16b	UTSW	2	142700099	intron	probably benign
R7003:Kif16b	UTSW	2	142758829	missense	possibly damaging	0.95
R7265:Kif16b	UTSW	2	142714730	missense	probably damaging	1.00
R7376:Kif16b	UTSW	2	142711872	missense	probably damaging	0.99
R7381:Kif16b	UTSW	2	142857423	missense	probably damaging	1.00
R7558:Kif16b	UTSW	2	142758826	missense	probably damaging	1.00
R7681:Kif16b	UTSW	2	142756126	missense	probably damaging	1.00
R7896:Kif16b	UTSW	2	142834075	critical splice donor site	probably null
R7956:Kif16b	UTSW	2	142862470	missense	probably benign	0.00
R8053:Kif16b	UTSW	2	142853714	missense	probably damaging	1.00
R8056:Kif16b	UTSW	2	142712842	missense	probably damaging	1.00
R8139:Kif16b	UTSW	2	142901365	missense	probably benign	0.00
R8182:Kif16b	UTSW	2	142712899	missense	possibly damaging	0.90
R8224:Kif16b	UTSW	2	142834088	missense	probably benign	0.03
R8357:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8359:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8360:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8369:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8385:Kif16b	UTSW	2	142712338	missense	probably benign	0.09
R8457:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8720:Kif16b	UTSW	2	142849872	missense	probably damaging	1.00
R8898:Kif16b	UTSW	2	142712979	missense	possibly damaging	0.81
R8987:Kif16b	UTSW	2	142849863	critical splice donor site	probably null
R8987:Kif16b	UTSW	2	142901358	missense	probably benign	0.00
R9022:Kif16b	UTSW	2	142712617	missense	possibly damaging	0.46
R9040:Kif16b	UTSW	2	142849878	missense	probably benign	0.02
R9044:Kif16b	UTSW	2	142699657	missense	possibly damaging	0.91
R9138:Kif16b	UTSW	2	142700556	missense
R9167:Kif16b	UTSW	2	142700920	nonsense	probably null
R9218:Kif16b	UTSW	2	142699663	missense	possibly damaging	0.77
R9283:Kif16b	UTSW	2	142712980	missense	probably benign	0.00
R9300:Kif16b	UTSW	2	142699287	missense	probably benign
R9378:Kif16b	UTSW	2	142619818	nonsense	probably null
R9522:Kif16b	UTSW	2	142849907	missense	probably damaging	0.96
R9588:Kif16b	UTSW	2	142711884	missense	possibly damaging	0.82
R9632:Kif16b	UTSW	2	142712040	missense	probably benign	0.00
R9641:Kif16b	UTSW	2	142700669	missense	probably benign	0.01
X0058:Kif16b	UTSW	2	142758861	missense	probably damaging	1.00
Z1177:Kif16b	UTSW	2	142711824	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGACCTTCTCAGCTTGTTCG -3'
(R):5'- TCCAGTTAGGGAGAAGTTGGAC -3'

Sequencing Primer
(F):5'- AGCTCTTGGAGTTTGCGAAGC -3'
(R):5'- TTGGACTGATGCTAAGCACAGTG -3'

Posted On

2019-06-26