Incidental Mutation 'R7307:Ythdf3'
ID567293
Institutional Source Beutler Lab
Gene Symbol Ythdf3
Ensembl Gene ENSMUSG00000047213
Gene NameYTH domain family 3
Synonyms9130022A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location16183212-16217037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16183500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000103983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108345] [ENSMUST00000108346] [ENSMUST00000191774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108345
AA Change: S2P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103982
Gene: ENSMUSG00000047213
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
low complexity region 134 161 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
low complexity region 289 351 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Pfam:YTH 415 553 1.5e-50 PFAM
low complexity region 567 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108346
AA Change: S2P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103983
Gene: ENSMUSG00000047213
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
low complexity region 145 172 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 300 362 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:YTH 427 562 1.1e-44 PFAM
low complexity region 578 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191774
SMART Domains Protein: ENSMUSP00000141610
Gene: ENSMUSG00000047213

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 138 165 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 293 355 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
Pfam:YTH 419 557 1.6e-50 PFAM
low complexity region 571 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193598
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Ythdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02585:Ythdf3 APN 3 16189478 missense probably benign 0.01
IGL03068:Ythdf3 APN 3 16204718 missense possibly damaging 0.92
Disinclined UTSW 3 16203192 nonsense probably null
R0501:Ythdf3 UTSW 3 16205072 missense probably damaging 0.98
R0644:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1667:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1940:Ythdf3 UTSW 3 16205092 missense possibly damaging 0.71
R2121:Ythdf3 UTSW 3 16205192 missense possibly damaging 0.71
R2191:Ythdf3 UTSW 3 16203211 intron probably benign
R2341:Ythdf3 UTSW 3 16203215 intron probably benign
R2512:Ythdf3 UTSW 3 16204895 missense possibly damaging 0.66
R2850:Ythdf3 UTSW 3 16203818 splice site probably benign
R3037:Ythdf3 UTSW 3 16205191 missense probably benign 0.32
R4934:Ythdf3 UTSW 3 16204056 missense probably damaging 0.97
R5007:Ythdf3 UTSW 3 16205198 missense possibly damaging 0.51
R5164:Ythdf3 UTSW 3 16183513 missense possibly damaging 0.67
R5172:Ythdf3 UTSW 3 16204034 missense probably damaging 1.00
R5480:Ythdf3 UTSW 3 16183500 missense possibly damaging 0.83
R5512:Ythdf3 UTSW 3 16183922 missense probably damaging 0.98
R6059:Ythdf3 UTSW 3 16203192 nonsense probably null
R6104:Ythdf3 UTSW 3 16205161 missense possibly damaging 0.51
R6273:Ythdf3 UTSW 3 16204856 missense possibly damaging 0.92
R6721:Ythdf3 UTSW 3 16203861 missense possibly damaging 0.72
R7187:Ythdf3 UTSW 3 16204287 missense probably benign 0.05
R7285:Ythdf3 UTSW 3 16203885 splice site probably null
R7816:Ythdf3 UTSW 3 16189517 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGACTGGATAGCGGAAGGTC -3'
(R):5'- AACAATCCGCGTAGGTGTG -3'

Sequencing Primer
(F):5'- ATTGTGGGCCCGAGGATC -3'
(R):5'- GTAGGTGTGAACCCCACCAGATC -3'
Posted On2019-06-26