Incidental Mutation 'R7307:Ythdf3'
ID 567293
Institutional Source Beutler Lab
Gene Symbol Ythdf3
Ensembl Gene ENSMUSG00000047213
Gene Name YTH N6-methyladenosine RNA binding protein 3
Synonyms 9130022A11Rik
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.354) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 16237376-16271201 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16237664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000103983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108345] [ENSMUST00000108346] [ENSMUST00000191774]
AlphaFold Q8BYK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000108345
AA Change: S2P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103982
Gene: ENSMUSG00000047213
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
low complexity region 134 161 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
low complexity region 289 351 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Pfam:YTH 415 553 1.5e-50 PFAM
low complexity region 567 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108346
AA Change: S2P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103983
Gene: ENSMUSG00000047213
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
low complexity region 145 172 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 300 362 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:YTH 427 562 1.1e-44 PFAM
low complexity region 578 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191774
SMART Domains Protein: ENSMUSP00000141610
Gene: ENSMUSG00000047213

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 138 165 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 293 355 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
Pfam:YTH 419 557 1.6e-50 PFAM
low complexity region 571 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193598
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Ythdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02585:Ythdf3 APN 3 16,243,642 (GRCm39) missense probably benign 0.01
IGL03068:Ythdf3 APN 3 16,258,882 (GRCm39) missense possibly damaging 0.92
Disinclined UTSW 3 16,257,356 (GRCm39) nonsense probably null
R0501:Ythdf3 UTSW 3 16,259,236 (GRCm39) missense probably damaging 0.98
R0644:Ythdf3 UTSW 3 16,259,056 (GRCm39) missense possibly damaging 0.46
R1667:Ythdf3 UTSW 3 16,259,056 (GRCm39) missense possibly damaging 0.46
R1940:Ythdf3 UTSW 3 16,259,256 (GRCm39) missense possibly damaging 0.71
R2121:Ythdf3 UTSW 3 16,259,356 (GRCm39) missense possibly damaging 0.71
R2191:Ythdf3 UTSW 3 16,257,375 (GRCm39) intron probably benign
R2341:Ythdf3 UTSW 3 16,257,379 (GRCm39) intron probably benign
R2512:Ythdf3 UTSW 3 16,259,059 (GRCm39) missense possibly damaging 0.66
R2850:Ythdf3 UTSW 3 16,257,982 (GRCm39) splice site probably benign
R3037:Ythdf3 UTSW 3 16,259,355 (GRCm39) missense probably benign 0.32
R4934:Ythdf3 UTSW 3 16,258,220 (GRCm39) missense probably damaging 0.97
R5007:Ythdf3 UTSW 3 16,259,362 (GRCm39) missense possibly damaging 0.51
R5164:Ythdf3 UTSW 3 16,237,677 (GRCm39) missense possibly damaging 0.67
R5172:Ythdf3 UTSW 3 16,258,198 (GRCm39) missense probably damaging 1.00
R5480:Ythdf3 UTSW 3 16,237,664 (GRCm39) missense possibly damaging 0.83
R5512:Ythdf3 UTSW 3 16,238,086 (GRCm39) missense probably damaging 0.98
R6059:Ythdf3 UTSW 3 16,257,356 (GRCm39) nonsense probably null
R6104:Ythdf3 UTSW 3 16,259,325 (GRCm39) missense possibly damaging 0.51
R6273:Ythdf3 UTSW 3 16,259,020 (GRCm39) missense possibly damaging 0.92
R6721:Ythdf3 UTSW 3 16,258,025 (GRCm39) missense possibly damaging 0.72
R7187:Ythdf3 UTSW 3 16,258,451 (GRCm39) missense probably benign 0.05
R7285:Ythdf3 UTSW 3 16,258,049 (GRCm39) splice site probably null
R7816:Ythdf3 UTSW 3 16,243,681 (GRCm39) missense probably damaging 0.96
R8499:Ythdf3 UTSW 3 16,259,179 (GRCm39) missense possibly damaging 0.85
R8754:Ythdf3 UTSW 3 16,258,138 (GRCm39) missense probably damaging 0.99
R9401:Ythdf3 UTSW 3 16,258,659 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGACTGGATAGCGGAAGGTC -3'
(R):5'- AACAATCCGCGTAGGTGTG -3'

Sequencing Primer
(F):5'- ATTGTGGGCCCGAGGATC -3'
(R):5'- GTAGGTGTGAACCCCACCAGATC -3'
Posted On 2019-06-26