Incidental Mutation 'R7307:Hsd3b5'
ID 567294
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms 3(beta)HSDV
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98525950-98537568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 98527085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 120 (F120L)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
AlphaFold Q61694
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: F120L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: F120L

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98,537,373 (GRCm39) missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98,537,414 (GRCm39) missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98,526,439 (GRCm39) missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98,529,475 (GRCm39) missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98,537,421 (GRCm39) missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98,529,343 (GRCm39) missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98,529,447 (GRCm39) missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98,526,460 (GRCm39) missense probably benign
R0624:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98,526,855 (GRCm39) missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98,526,671 (GRCm39) missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98,537,393 (GRCm39) missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98,526,846 (GRCm39) missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98,529,393 (GRCm39) missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98,527,036 (GRCm39) missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98,527,044 (GRCm39) missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98,526,528 (GRCm39) missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98,527,116 (GRCm39) missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98,529,375 (GRCm39) missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98,526,964 (GRCm39) missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98,526,379 (GRCm39) missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98,526,592 (GRCm39) missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98,526,466 (GRCm39) missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98,537,406 (GRCm39) missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98,529,328 (GRCm39) missense probably damaging 1.00
R7339:Hsd3b5 UTSW 3 98,529,390 (GRCm39) missense probably damaging 1.00
R7615:Hsd3b5 UTSW 3 98,537,420 (GRCm39) missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98,526,757 (GRCm39) missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98,529,456 (GRCm39) missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense possibly damaging 0.85
R9218:Hsd3b5 UTSW 3 98,526,354 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTCTTCCCCATAGATGAAAGGG -3'
(R):5'- AGTGGGAATGCATTTAGCCTG -3'

Sequencing Primer
(F):5'- GCAAAGTGCCACCATTTTTCAGG -3'
(R):5'- CTGTAGTGGCCCTTTCACGG -3'
Posted On 2019-06-26