Incidental Mutation 'R7307:Syde2'
ID 567299
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Name synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Synonyms C430017H16Rik
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 145693625-145727475 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 145721553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1140 (V1140D)
Ref Sequence ENSEMBL: ENSMUSP00000041897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
AlphaFold E9PUP1
Predicted Effect probably damaging
Transcript: ENSMUST00000039517
AA Change: V1140D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863
AA Change: V1140D

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200546
AA Change: V872D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863
AA Change: V872D

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212479
AA Change: V873D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 145,720,096 (GRCm39) missense possibly damaging 0.76
IGL01624:Syde2 APN 3 145,712,790 (GRCm39) missense probably damaging 1.00
IGL02059:Syde2 APN 3 145,707,927 (GRCm39) missense possibly damaging 0.77
IGL02195:Syde2 APN 3 145,707,911 (GRCm39) missense probably damaging 1.00
IGL02498:Syde2 APN 3 145,704,444 (GRCm39) missense probably benign 0.08
IGL02609:Syde2 APN 3 145,704,275 (GRCm39) missense probably benign 0.00
IGL02721:Syde2 APN 3 145,707,759 (GRCm39) missense probably damaging 1.00
IGL02932:Syde2 APN 3 145,707,231 (GRCm39) missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145,694,934 (GRCm39) splice site probably benign
R0062:Syde2 UTSW 3 145,704,508 (GRCm39) missense probably benign 0.00
R0062:Syde2 UTSW 3 145,704,508 (GRCm39) missense probably benign 0.00
R0413:Syde2 UTSW 3 145,712,887 (GRCm39) missense probably damaging 1.00
R0505:Syde2 UTSW 3 145,720,135 (GRCm39) missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145,694,925 (GRCm39) critical splice donor site probably null
R0646:Syde2 UTSW 3 145,720,004 (GRCm39) splice site probably null
R1535:Syde2 UTSW 3 145,708,176 (GRCm39) splice site probably benign
R1914:Syde2 UTSW 3 145,720,071 (GRCm39) nonsense probably null
R1915:Syde2 UTSW 3 145,720,071 (GRCm39) nonsense probably null
R1997:Syde2 UTSW 3 145,704,746 (GRCm39) missense probably benign 0.08
R2012:Syde2 UTSW 3 145,694,163 (GRCm39) missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145,704,241 (GRCm39) missense possibly damaging 0.52
R2220:Syde2 UTSW 3 145,707,713 (GRCm39) missense probably benign 0.07
R2990:Syde2 UTSW 3 145,707,252 (GRCm39) missense probably damaging 0.97
R4022:Syde2 UTSW 3 145,721,480 (GRCm39) missense probably benign 0.25
R5077:Syde2 UTSW 3 145,707,764 (GRCm39) missense probably damaging 1.00
R5084:Syde2 UTSW 3 145,707,163 (GRCm39) nonsense probably null
R5084:Syde2 UTSW 3 145,707,164 (GRCm39) frame shift probably null
R5086:Syde2 UTSW 3 145,707,163 (GRCm39) nonsense probably null
R5087:Syde2 UTSW 3 145,707,163 (GRCm39) nonsense probably null
R5087:Syde2 UTSW 3 145,712,881 (GRCm39) missense probably damaging 1.00
R5101:Syde2 UTSW 3 145,721,393 (GRCm39) missense probably damaging 1.00
R5211:Syde2 UTSW 3 145,707,093 (GRCm39) missense probably benign 0.01
R5842:Syde2 UTSW 3 145,704,775 (GRCm39) missense probably benign 0.00
R6025:Syde2 UTSW 3 145,712,896 (GRCm39) splice site probably null
R6352:Syde2 UTSW 3 145,704,229 (GRCm39) nonsense probably null
R6384:Syde2 UTSW 3 145,704,568 (GRCm39) missense probably damaging 1.00
R6769:Syde2 UTSW 3 145,704,803 (GRCm39) missense probably damaging 0.98
R6771:Syde2 UTSW 3 145,704,803 (GRCm39) missense probably damaging 0.98
R6970:Syde2 UTSW 3 145,694,381 (GRCm39) missense probably benign 0.15
R6988:Syde2 UTSW 3 145,725,564 (GRCm39) missense probably benign 0.31
R7067:Syde2 UTSW 3 145,694,019 (GRCm39) missense probably benign 0.00
R7146:Syde2 UTSW 3 145,712,870 (GRCm39) nonsense probably null
R7191:Syde2 UTSW 3 145,708,113 (GRCm39) missense probably benign 0.04
R7246:Syde2 UTSW 3 145,694,510 (GRCm39) missense probably benign 0.22
R7271:Syde2 UTSW 3 145,726,031 (GRCm39) missense possibly damaging 0.71
R7875:Syde2 UTSW 3 145,726,020 (GRCm39) missense probably damaging 1.00
R7903:Syde2 UTSW 3 145,704,543 (GRCm39) missense probably damaging 1.00
R7918:Syde2 UTSW 3 145,708,170 (GRCm39) critical splice donor site probably null
R8016:Syde2 UTSW 3 145,707,727 (GRCm39) missense possibly damaging 0.82
R8185:Syde2 UTSW 3 145,694,667 (GRCm39) missense probably benign
R8328:Syde2 UTSW 3 145,721,496 (GRCm39) missense probably benign 0.31
R8913:Syde2 UTSW 3 145,708,148 (GRCm39) missense probably damaging 1.00
R9800:Syde2 UTSW 3 145,704,364 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCTGAAACTGGTGGCCTCC -3'
(R):5'- CGATGGCTCAAATGTCTACAATG -3'

Sequencing Primer
(F):5'- TGGCCTCCTACCACGAAG -3'
(R):5'- TCCAGACATCCCATTGCT -3'
Posted On 2019-06-26