Incidental Mutation 'R7307:Sgsm1'
ID 567303
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, D5Bwg1524e, 2410098H20Rik
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113391086-113458652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113421512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 525 (D525G)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
AA Change: D525G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: D525G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
AA Change: D238G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: D238G

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: D525G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: D525G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154248
AA Change: D580G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: D580G

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.2496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113,392,930 (GRCm39) missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113,424,008 (GRCm39) missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113,424,048 (GRCm39) splice site probably benign
IGL01602:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113,411,356 (GRCm39) missense probably benign
IGL01920:Sgsm1 APN 5 113,421,471 (GRCm39) missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL02387:Sgsm1 APN 5 113,400,929 (GRCm39) missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL03177:Sgsm1 APN 5 113,398,859 (GRCm39) missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113,432,887 (GRCm39) missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113,403,182 (GRCm39) missense possibly damaging 0.67
caliente UTSW 5 113,428,328 (GRCm39) intron probably benign
Chili UTSW 5 113,405,989 (GRCm39) intron probably benign
pimiento UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113,416,616 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113,436,702 (GRCm39) missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113,427,136 (GRCm39) splice site probably benign
R0099:Sgsm1 UTSW 5 113,422,226 (GRCm39) splice site probably benign
R0269:Sgsm1 UTSW 5 113,434,795 (GRCm39) critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113,411,571 (GRCm39) missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113,436,701 (GRCm39) missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113,411,625 (GRCm39) missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113,458,428 (GRCm39) missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113,392,894 (GRCm39) missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113,432,989 (GRCm39) splice site probably benign
R0744:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113,406,708 (GRCm39) missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113,413,740 (GRCm39) missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113,427,351 (GRCm39) missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113,421,577 (GRCm39) nonsense probably null
R1473:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113,411,135 (GRCm39) missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113,421,483 (GRCm39) missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113,411,381 (GRCm39) missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113,433,266 (GRCm39) missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113,433,270 (GRCm39) missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113,405,989 (GRCm39) intron probably benign
R4558:Sgsm1 UTSW 5 113,405,977 (GRCm39) intron probably benign
R4610:Sgsm1 UTSW 5 113,403,173 (GRCm39) missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113,407,913 (GRCm39) critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113,430,492 (GRCm39) missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113,428,328 (GRCm39) intron probably benign
R4992:Sgsm1 UTSW 5 113,430,486 (GRCm39) missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113,398,905 (GRCm39) missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113,398,823 (GRCm39) missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113,398,822 (GRCm39) missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113,434,704 (GRCm39) missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113,430,522 (GRCm39) missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113,426,997 (GRCm39) critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113,428,246 (GRCm39) missense probably damaging 0.97
R7309:Sgsm1 UTSW 5 113,416,712 (GRCm39) splice site probably null
R7387:Sgsm1 UTSW 5 113,411,566 (GRCm39) missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113,422,187 (GRCm39) missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113,427,501 (GRCm39) splice site probably null
R7624:Sgsm1 UTSW 5 113,422,201 (GRCm39) nonsense probably null
R7632:Sgsm1 UTSW 5 113,423,948 (GRCm39) missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113,400,890 (GRCm39) missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113,422,193 (GRCm39) missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113,414,196 (GRCm39) missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113,430,510 (GRCm39) missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113,403,134 (GRCm39) missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113,398,877 (GRCm39) missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113,407,958 (GRCm39) missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113,411,284 (GRCm39) missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113,435,097 (GRCm39) missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113,432,861 (GRCm39) missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113,436,725 (GRCm39) missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113,430,577 (GRCm39) missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113,428,201 (GRCm39) missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113,422,139 (GRCm39) missense unknown
R9377:Sgsm1 UTSW 5 113,436,741 (GRCm39) missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113,423,898 (GRCm39) critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113,427,097 (GRCm39) missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113,428,207 (GRCm39) missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113,458,418 (GRCm39) missense probably benign
Z1177:Sgsm1 UTSW 5 113,430,576 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGGGACTCAAGTCAGC -3'
(R):5'- GGGACAATGAGAATTTTCTGGG -3'

Sequencing Primer
(F):5'- GGACTCAAGTCAGCTGTGG -3'
(R):5'- ACAATGAGAATTTTCTGGGTTGAGAG -3'
Posted On 2019-06-26