Incidental Mutation 'R7307:Rbm19'
ID567304
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene NameRNA binding motif protein 19
Synonyms1200009A02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028762 ; MGI: 1921361

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120116465-120198981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120186218 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 881 (K881E)
Ref Sequence ENSEMBL: ENSMUSP00000031590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
PDB Structure
Solution structure of the N-terminal RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the second RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the penultimate RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Solution structure of the C-terminal RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031590
AA Change: K881E

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594
AA Change: K881E

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202777
AA Change: E863G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594
AA Change: E863G

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120143438 splice site probably benign
IGL01750:Rbm19 APN 5 120118792 missense probably benign 0.00
IGL01830:Rbm19 APN 5 120124695 missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120120236 missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120143405 missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120131246 missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120122958 missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120144097 missense probably damaging 0.99
PIT4812001:Rbm19 UTSW 5 120128250 missense possibly damaging 0.91
R0190:Rbm19 UTSW 5 120144046 missense probably benign 0.30
R0350:Rbm19 UTSW 5 120128307 missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120128316 critical splice donor site probably null
R0924:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0930:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0963:Rbm19 UTSW 5 120130734 missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120123016 missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120122896 missense probably benign 0.01
R1441:Rbm19 UTSW 5 120131176 missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120144029 missense probably benign 0.00
R1518:Rbm19 UTSW 5 120140280 small deletion probably benign
R1992:Rbm19 UTSW 5 120133883 critical splice donor site probably null
R2029:Rbm19 UTSW 5 120120242 missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120133010 missense probably damaging 1.00
R4356:Rbm19 UTSW 5 120140362 missense possibly damaging 0.72
R4808:Rbm19 UTSW 5 120118774 missense probably damaging 0.99
R4817:Rbm19 UTSW 5 120133734 intron probably benign
R4857:Rbm19 UTSW 5 120132833 splice site probably benign
R4963:Rbm19 UTSW 5 120141566 missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120141577 missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120132942 missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120132867 missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120140307 missense probably benign 0.01
R6345:Rbm19 UTSW 5 120127040 missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120120130 missense probably benign 0.06
R6495:Rbm19 UTSW 5 120119680 missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120123151 critical splice donor site probably null
R7181:Rbm19 UTSW 5 120116467 unclassified probably benign
R8058:Rbm19 UTSW 5 120140375 critical splice donor site probably null
R8432:Rbm19 UTSW 5 120175926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCTCCTTCATGTCAAAC -3'
(R):5'- ATCCAAGGTGGCTTGAAGTG -3'

Sequencing Primer
(F):5'- CATAGCTCACTAGTGAAGTAAGTGTG -3'
(R):5'- CCAAGTGAGGGCAGCGATC -3'
Posted On2019-06-26