Incidental Mutation 'R7307:Rbm19'
ID 567304
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene Name RNA binding motif protein 19
Synonyms 1200009A02Rik
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120254578-120337036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120324283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 881 (K881E)
Ref Sequence ENSEMBL: ENSMUSP00000031590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
AlphaFold Q8R3C6
PDB Structure Solution structure of the N-terminal RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the second RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the penultimate RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Solution structure of the C-terminal RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031590
AA Change: K881E

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594
AA Change: K881E

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202777
AA Change: E863G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594
AA Change: E863G

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120,281,503 (GRCm39) splice site probably benign
IGL01750:Rbm19 APN 5 120,256,857 (GRCm39) missense probably benign 0.00
IGL01830:Rbm19 APN 5 120,262,760 (GRCm39) missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120,258,301 (GRCm39) missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120,281,470 (GRCm39) missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120,269,311 (GRCm39) missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120,261,023 (GRCm39) missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120,282,162 (GRCm39) missense probably damaging 0.99
PIT4812001:Rbm19 UTSW 5 120,266,315 (GRCm39) missense possibly damaging 0.91
R0190:Rbm19 UTSW 5 120,282,111 (GRCm39) missense probably benign 0.30
R0350:Rbm19 UTSW 5 120,266,372 (GRCm39) missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120,266,381 (GRCm39) critical splice donor site probably null
R0924:Rbm19 UTSW 5 120,264,269 (GRCm39) missense probably benign 0.11
R0930:Rbm19 UTSW 5 120,264,269 (GRCm39) missense probably benign 0.11
R0963:Rbm19 UTSW 5 120,268,799 (GRCm39) missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120,261,081 (GRCm39) missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120,260,961 (GRCm39) missense probably benign 0.01
R1441:Rbm19 UTSW 5 120,269,241 (GRCm39) missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120,282,094 (GRCm39) missense probably benign 0.00
R1518:Rbm19 UTSW 5 120,278,345 (GRCm39) small deletion probably benign
R1992:Rbm19 UTSW 5 120,271,948 (GRCm39) critical splice donor site probably null
R2029:Rbm19 UTSW 5 120,258,307 (GRCm39) missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120,271,075 (GRCm39) missense probably damaging 1.00
R4356:Rbm19 UTSW 5 120,278,427 (GRCm39) missense possibly damaging 0.72
R4808:Rbm19 UTSW 5 120,256,839 (GRCm39) missense probably damaging 0.99
R4817:Rbm19 UTSW 5 120,271,799 (GRCm39) intron probably benign
R4857:Rbm19 UTSW 5 120,270,898 (GRCm39) splice site probably benign
R4963:Rbm19 UTSW 5 120,279,631 (GRCm39) missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120,279,642 (GRCm39) missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120,271,007 (GRCm39) missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120,270,932 (GRCm39) missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120,278,372 (GRCm39) missense probably benign 0.01
R6345:Rbm19 UTSW 5 120,265,105 (GRCm39) missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120,258,195 (GRCm39) missense probably benign 0.06
R6495:Rbm19 UTSW 5 120,257,745 (GRCm39) missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120,261,216 (GRCm39) critical splice donor site probably null
R7181:Rbm19 UTSW 5 120,254,532 (GRCm39) unclassified probably benign
R8058:Rbm19 UTSW 5 120,278,440 (GRCm39) critical splice donor site probably null
R8432:Rbm19 UTSW 5 120,313,991 (GRCm39) missense probably damaging 1.00
R8696:Rbm19 UTSW 5 120,265,132 (GRCm39) missense probably damaging 0.98
R8910:Rbm19 UTSW 5 120,271,844 (GRCm39) missense probably damaging 1.00
R9261:Rbm19 UTSW 5 120,256,810 (GRCm39) missense probably damaging 1.00
R9424:Rbm19 UTSW 5 120,278,345 (GRCm39) small deletion probably benign
R9507:Rbm19 UTSW 5 120,265,232 (GRCm39) critical splice donor site probably null
R9695:Rbm19 UTSW 5 120,335,986 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCTCCTTCATGTCAAAC -3'
(R):5'- ATCCAAGGTGGCTTGAAGTG -3'

Sequencing Primer
(F):5'- CATAGCTCACTAGTGAAGTAAGTGTG -3'
(R):5'- CCAAGTGAGGGCAGCGATC -3'
Posted On 2019-06-26