Incidental Mutation 'R0637:Clca3b'
ID 56731
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 038826-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0637 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144533701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 558 (V558D)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: V558D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: V558D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,498,831 (GRCm39) D285N probably damaging Het
Aldh3a1 G A 11: 61,106,304 (GRCm39) probably benign Het
Alms1 A G 6: 85,600,015 (GRCm39) T2083A possibly damaging Het
Atrip C T 9: 108,890,241 (GRCm39) M143I possibly damaging Het
Aup1 T A 6: 83,033,842 (GRCm39) V344D probably damaging Het
Baiap2 G A 11: 119,891,405 (GRCm39) V511M probably benign Het
Bnip2 T A 9: 69,910,955 (GRCm39) probably null Het
Cacna1i A T 15: 80,256,855 (GRCm39) Y1083F probably damaging Het
Cbr4 T C 8: 61,943,740 (GRCm39) probably benign Het
Ces2b C T 8: 105,561,237 (GRCm39) probably benign Het
Chd1 A G 17: 15,962,550 (GRCm39) N769S possibly damaging Het
Col12a1 T C 9: 79,564,017 (GRCm39) D1736G probably benign Het
Cpne8 C A 15: 90,532,824 (GRCm39) C61F probably damaging Het
Cxcr1 A G 1: 74,231,998 (GRCm39) I8T probably benign Het
D630003M21Rik T G 2: 158,037,327 (GRCm39) probably benign Het
Dcaf17 T A 2: 70,890,763 (GRCm39) D99E probably damaging Het
Fbf1 C T 11: 116,050,880 (GRCm39) probably benign Het
Fgfr2 T A 7: 129,773,354 (GRCm39) H570L possibly damaging Het
Gars1 G A 6: 55,046,472 (GRCm39) probably null Het
Gm10309 A G 17: 86,806,463 (GRCm39) probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm9892 G A 8: 52,649,860 (GRCm39) Q78* probably null Het
Has1 A G 17: 18,064,125 (GRCm39) Y505H possibly damaging Het
Hivep3 T A 4: 119,989,738 (GRCm39) L2063* probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,481,734 (GRCm39) probably benign Het
Itgb3 T C 11: 104,549,702 (GRCm39) V614A probably benign Het
Lrrc23 A G 6: 124,755,321 (GRCm39) probably benign Het
Lrrc63 A T 14: 75,335,660 (GRCm39) probably benign Het
Mfhas1 C T 8: 36,057,180 (GRCm39) R357* probably null Het
Mink1 C A 11: 70,492,502 (GRCm39) N123K probably damaging Het
Mtmr4 A G 11: 87,501,890 (GRCm39) H591R probably benign Het
Nav3 T C 10: 109,606,058 (GRCm39) T923A probably benign Het
Ncapg A G 5: 45,844,666 (GRCm39) T554A probably damaging Het
Nfe2l1 T C 11: 96,718,514 (GRCm39) Y7C probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Obscn A T 11: 58,942,470 (GRCm39) M4904K probably damaging Het
Obscn G T 11: 58,973,602 (GRCm39) L1910I probably damaging Het
Or8b41 T C 9: 38,055,178 (GRCm39) F244S probably benign Het
Pcdhb15 T A 18: 37,608,619 (GRCm39) V617E probably damaging Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Pgrmc1 T C X: 35,865,924 (GRCm39) F160S probably damaging Het
Pink1 G T 4: 138,045,357 (GRCm39) P239Q probably damaging Het
Pramel25 A T 4: 143,520,479 (GRCm39) Y77F probably benign Het
Prr27 A G 5: 87,999,005 (GRCm39) probably benign Het
Rbpms G A 8: 34,296,864 (GRCm39) P138S probably damaging Het
Rcc2 T C 4: 140,445,055 (GRCm39) probably benign Het
Rgs3 T C 4: 62,564,910 (GRCm39) probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 C T 16: 72,798,839 (GRCm39) T933M probably benign Het
Sinhcaf A G 6: 148,832,163 (GRCm39) probably benign Het
Steap4 T C 5: 8,028,398 (GRCm39) probably benign Het
Tenm3 T C 8: 48,689,560 (GRCm39) Y2009C probably damaging Het
Tnr A C 1: 159,677,905 (GRCm39) T97P possibly damaging Het
Topaz1 T A 9: 122,620,542 (GRCm39) L1320* probably null Het
Topaz1 A G 9: 122,626,727 (GRCm39) M1452V probably benign Het
Trank1 T G 9: 111,219,509 (GRCm39) F2082C probably damaging Het
Trim24 C A 6: 37,935,494 (GRCm39) probably null Het
Tspoap1 T A 11: 87,668,066 (GRCm39) probably benign Het
Ubr4 T C 4: 139,126,926 (GRCm39) L483P probably damaging Het
Vmn2r2 T A 3: 64,033,999 (GRCm39) T508S probably benign Het
Vps18 C T 2: 119,124,386 (GRCm39) R438C probably damaging Het
Zfp366 C A 13: 99,365,474 (GRCm39) R212S probably damaging Het
Zkscan4 T A 13: 21,665,477 (GRCm39) C122S probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGTAAGTCCAAGTGCCTGTCTG -3'
(R):5'- GGAGAGCAAAGCCTTCAATGTCGG -3'

Sequencing Primer
(F):5'- gctgtactgttgagatattgcc -3'
(R):5'- AGCCTTCAATGTCGGAGCAG -3'
Posted On 2013-07-11