Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Nup98'

567311

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102119398-102210176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102134795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1093 (I1093T)

Ref Sequence

ENSEMBL: ENSMUSP00000147486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070165
AA Change: I1110T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: I1110T

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000210682
AA Change: I1110T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000211235
AA Change: I1093T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	102194987	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	102153971	missense	probably benign
IGL00798:Nup98	APN	7	102147204	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	102185918	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	102194711	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	102183486	missense	probably benign	0.37
IGL02490:Nup98	APN	7	102152366	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	102183545	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	102134964	missense	probably benign	0.00
R0040:Nup98	UTSW	7	102192034	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	102139652	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	102152428	missense	probably null
R0471:Nup98	UTSW	7	102138797	missense	probably benign	0.13
R0538:Nup98	UTSW	7	102186685	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	102152453	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	102134880	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	102134937	missense	probably benign	0.03
R1889:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	102180424	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	102184877	missense	probably benign	0.03
R4361:Nup98	UTSW	7	102145714	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	102184831	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	102153196	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	102195800	missense	unknown
R4924:Nup98	UTSW	7	102134978	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5069:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5233:Nup98	UTSW	7	102195822	missense	unknown
R5779:Nup98	UTSW	7	102152361	missense	probably benign
R5922:Nup98	UTSW	7	102154017	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	102180429	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6343:Nup98	UTSW	7	102194750	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	102176315	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	102195016	missense	probably benign	0.03
R6577:Nup98	UTSW	7	102128846	splice site	probably null
R6900:Nup98	UTSW	7	102185962	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	102195041	missense	unknown
R7218:Nup98	UTSW	7	102191900	splice site	probably null
R7235:Nup98	UTSW	7	102125284	missense	probably damaging	1.00
R7402:Nup98	UTSW	7	102134937	missense	probably benign	0.00
R7427:Nup98	UTSW	7	102135001	splice site	probably null
R7428:Nup98	UTSW	7	102135001	splice site	probably null
R7584:Nup98	UTSW	7	102176389	missense	probably benign	0.02
R7646:Nup98	UTSW	7	102154035	missense	probably benign	0.01
R7648:Nup98	UTSW	7	102124197	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	102153257	splice site	probably null
R7827:Nup98	UTSW	7	102124362	missense	probably benign	0.10
R7884:Nup98	UTSW	7	102176349	missense	probably benign	0.12
R7943:Nup98	UTSW	7	102194822	missense	probably benign	0.10
R8034:Nup98	UTSW	7	102145723	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	102186652	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	102134688	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	102194966	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9148:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9223:Nup98	UTSW	7	102184960	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9249:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9272:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9274:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9283:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9326:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9466:Nup98	UTSW	7	102169404	missense	probably benign	0.05
R9492:Nup98	UTSW	7	102129045	missense	probably benign	0.11
R9661:Nup98	UTSW	7	102132812	nonsense	probably null
T0970:Nup98	UTSW	7	102186752	unclassified	probably benign
X0054:Nup98	UTSW	7	102147208	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTACTGGATTGGGCAG -3'
(R):5'- TTGCAAGTGGAACTTTTCTTTCACC -3'

Sequencing Primer
(F):5'- GGCAACCTGATGATTTTCCAG -3'
(R):5'- CAAGTGCCTCCGTGCAAGAATG -3'

Posted On

2019-06-26