Incidental Mutation 'R7307:Or52a20'
ID 567312
Institutional Source Beutler Lab
Gene Symbol Or52a20
Ensembl Gene ENSMUSG00000094822
Gene Name olfactory receptor family 52 subfamily A member 20
Synonyms GA_x6K02T2PBJ9-6440320-6440766, GA_x6K02T2L9TJ-1933-2295, Olfr243, Olfr627, MOR22-4
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103365803-103366753 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103366173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 124 (R124L)
Ref Sequence ENSEMBL: ENSMUSP00000150329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098194] [ENSMUST00000215723]
AlphaFold E9PV96
Predicted Effect probably damaging
Transcript: ENSMUST00000098194
AA Change: R124L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095796
Gene: ENSMUSG00000094822
AA Change: R124L

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 1.6e-105 PFAM
Pfam:7tm_1 43 295 4.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215723
AA Change: R124L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Or52a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Or52a20 APN 7 103,366,328 (GRCm39) missense probably benign 0.06
IGL01550:Or52a20 APN 7 103,366,204 (GRCm39) missense probably damaging 0.98
IGL02698:Or52a20 APN 7 103,366,485 (GRCm39) missense probably damaging 1.00
IGL02795:Or52a20 APN 7 103,366,090 (GRCm39) missense probably benign 0.24
IGL02949:Or52a20 APN 7 103,366,427 (GRCm39) missense probably benign 0.00
IGL03326:Or52a20 APN 7 103,366,069 (GRCm39) missense probably benign 0.12
R1605:Or52a20 UTSW 7 103,365,858 (GRCm39) missense probably damaging 0.99
R1676:Or52a20 UTSW 7 103,366,319 (GRCm39) missense probably benign
R1973:Or52a20 UTSW 7 103,365,804 (GRCm39) start codon destroyed probably null 0.93
R2897:Or52a20 UTSW 7 103,366,749 (GRCm39) missense probably benign
R4667:Or52a20 UTSW 7 103,365,845 (GRCm39) missense probably benign 0.00
R4883:Or52a20 UTSW 7 103,365,914 (GRCm39) missense probably benign
R4955:Or52a20 UTSW 7 103,365,912 (GRCm39) missense probably benign 0.42
R5322:Or52a20 UTSW 7 103,366,319 (GRCm39) missense probably benign
R5384:Or52a20 UTSW 7 103,366,562 (GRCm39) missense probably benign 0.12
R5386:Or52a20 UTSW 7 103,366,562 (GRCm39) missense probably benign 0.12
R5523:Or52a20 UTSW 7 103,366,687 (GRCm39) nonsense probably null
R7743:Or52a20 UTSW 7 103,366,560 (GRCm39) missense possibly damaging 0.49
R8006:Or52a20 UTSW 7 103,366,532 (GRCm39) missense probably damaging 0.98
R9106:Or52a20 UTSW 7 103,366,737 (GRCm39) missense probably benign
R9581:Or52a20 UTSW 7 103,365,788 (GRCm39) start gained probably benign
R9681:Or52a20 UTSW 7 103,366,475 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACCTCTTCCTAGCAATGC -3'
(R):5'- GAACATCTTCTGCTGCCAGC -3'

Sequencing Primer
(F):5'- GCTTGGAGCAACAGACATTG -3'
(R):5'- AGCTTCACAATGGCCATGTG -3'
Posted On 2019-06-26