Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Tecta'

567319

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42377992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 426 (S426P)

Ref Sequence

ENSEMBL: ENSMUSP00000040262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

AlphaFold

O08523

Predicted Effect

probably damaging
Transcript: ENSMUST00000042190
AA Change: S426P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: S426P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160940
AA Change: S426P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: S426P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
cover	UTSW	9	42343887	missense	probably benign	0.05
lid	UTSW	9	42373110	missense	probably damaging	0.99
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0691:Tecta	UTSW	9	42384341	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1216:Tecta	UTSW	9	42377907	missense	probably benign	0.44
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5387:Tecta	UTSW	9	42375063	missense	probably damaging	0.98
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6850:Tecta	UTSW	9	42343838	missense	probably benign	0.20
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00
R7939:Tecta	UTSW	9	42388223	missense	probably damaging	0.99
R7966:Tecta	UTSW	9	42394962	missense	probably damaging	0.98
R7967:Tecta	UTSW	9	42377955	missense	possibly damaging	0.95
R8000:Tecta	UTSW	9	42367184	nonsense	probably null
R8064:Tecta	UTSW	9	42394955	missense	possibly damaging	0.94
R8117:Tecta	UTSW	9	42377631	missense	probably damaging	1.00
R8176:Tecta	UTSW	9	42359169	missense	probably damaging	0.97
R8284:Tecta	UTSW	9	42378029	missense	possibly damaging	0.89
R8315:Tecta	UTSW	9	42387825	critical splice acceptor site	probably null
R8321:Tecta	UTSW	9	42373053	missense	probably damaging	1.00
R8332:Tecta	UTSW	9	42375014	missense	probably damaging	1.00
R8437:Tecta	UTSW	9	42332560	missense	probably damaging	0.98
R8496:Tecta	UTSW	9	42330251	missense	probably benign	0.01
R8514:Tecta	UTSW	9	42373110	missense	probably damaging	0.99
R8683:Tecta	UTSW	9	42366972	missense	probably damaging	0.96
R8856:Tecta	UTSW	9	42373301	missense	probably benign	0.13
R8886:Tecta	UTSW	9	42367063	missense	probably benign	0.37
R9047:Tecta	UTSW	9	42375079	missense	probably benign	0.00
R9106:Tecta	UTSW	9	42367183	missense	probably benign	0.05
R9332:Tecta	UTSW	9	42372897	missense	probably damaging	1.00
R9352:Tecta	UTSW	9	42337851	missense	probably damaging	1.00
R9462:Tecta	UTSW	9	42337280	missense	probably damaging	1.00
R9535:Tecta	UTSW	9	42359463	missense	probably damaging	0.99
R9564:Tecta	UTSW	9	42337827	missense	probably damaging	0.97
R9592:Tecta	UTSW	9	42338942	missense	probably damaging	1.00
R9715:Tecta	UTSW	9	42375300	missense	probably damaging	1.00
Z1176:Tecta	UTSW	9	42392094	missense	probably damaging	0.99
Z1177:Tecta	UTSW	9	42375576	missense	probably benign	0.00
Z1177:Tecta	UTSW	9	42392070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTTCCAGTCAGCATGGTAG -3'
(R):5'- AGTCTGAAAACTCGGGGTGAC -3'

Sequencing Primer
(F):5'- TTCCAGTCAGCATGGTAGACACG -3'
(R):5'- GGTGACCACTCTCTCCTAAATAG -3'

Posted On

2019-06-26