Incidental Mutation 'R0637:Rgs3'
ID56732
Institutional Source Beutler Lab
Gene Symbol Rgs3
Ensembl Gene ENSMUSG00000059810
Gene Nameregulator of G-protein signaling 3
SynonymsC2pa, PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0637 (G1)
Quality Score218
Status Validated
Chromosome4
Chromosomal Location62559847-62704001 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 62646673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065870] [ENSMUST00000084521] [ENSMUST00000098031] [ENSMUST00000107424]
Predicted Effect probably benign
Transcript: ENSMUST00000065870
SMART Domains Protein: ENSMUSP00000065447
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
C2 47 150 7.98e-15 SMART
PDZ 203 272 8.09e-10 SMART
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084521
SMART Domains Protein: ENSMUSP00000081569
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
internal_repeat_1 407 447 2.05e-9 PROSPERO
internal_repeat_1 456 501 2.05e-9 PROSPERO
low complexity region 645 674 N/A INTRINSIC
RGS 841 957 3.66e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098031
SMART Domains Protein: ENSMUSP00000095639
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
C2 39 142 7.98e-15 SMART
PDZ 195 264 8.09e-10 SMART
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107424
SMART Domains Protein: ENSMUSP00000103047
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144489
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired T cell migration in model of Th2-mediated airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Rgs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rgs3 APN 4 62701180 missense possibly damaging 0.87
IGL00918:Rgs3 APN 4 62701067 missense probably damaging 1.00
IGL01594:Rgs3 APN 4 62619744 missense probably damaging 0.99
IGL01761:Rgs3 APN 4 62652709 splice site probably benign
IGL02995:Rgs3 APN 4 62625847 missense possibly damaging 0.95
IGL03365:Rgs3 APN 4 62689675 missense probably benign
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0158:Rgs3 UTSW 4 62623884 missense probably damaging 1.00
R0609:Rgs3 UTSW 4 62625936 missense probably damaging 1.00
R0633:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0893:Rgs3 UTSW 4 62605561 splice site probably null
R1612:Rgs3 UTSW 4 62625935 missense probably damaging 0.99
R1929:Rgs3 UTSW 4 62702147 missense probably damaging 1.00
R2202:Rgs3 UTSW 4 62690504 missense probably damaging 1.00
R2239:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2380:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2974:Rgs3 UTSW 4 62640720 missense probably damaging 1.00
R4871:Rgs3 UTSW 4 62631295 missense probably benign 0.01
R5229:Rgs3 UTSW 4 62702187 missense probably damaging 1.00
R5372:Rgs3 UTSW 4 62652697 intron probably benign
R5597:Rgs3 UTSW 4 62623845 missense probably damaging 1.00
R6006:Rgs3 UTSW 4 62623906 missense probably damaging 1.00
R6056:Rgs3 UTSW 4 62625906 missense probably damaging 0.96
R6732:Rgs3 UTSW 4 62602943 missense probably benign 0.00
R6962:Rgs3 UTSW 4 62700715 intron probably benign
R7141:Rgs3 UTSW 4 62690487 missense probably damaging 1.00
R7156:Rgs3 UTSW 4 62617126 missense probably damaging 0.99
R7193:Rgs3 UTSW 4 62615336 missense probably damaging 0.99
R7459:Rgs3 UTSW 4 62625154 missense probably benign 0.01
R7660:Rgs3 UTSW 4 62701112 missense possibly damaging 0.94
R7697:Rgs3 UTSW 4 62657142 missense probably benign 0.00
R8025:Rgs3 UTSW 4 62690594 missense probably damaging 0.97
Z1177:Rgs3 UTSW 4 62631214 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGCCATCAGAGGGTCTCCTTTCC -3'
(R):5'- AGAGCAAGAAACTGCCCTGACG -3'

Sequencing Primer
(F):5'- AGCATTTCCTGGGTCAGGC -3'
(R):5'- ACGTTTGTCTTAGGTCACTGTAAGAG -3'
Posted On2013-07-11