Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Frk'

567323

Institutional Source

Beutler Lab

Gene Symbol

Frk

Ensembl Gene

ENSMUSG00000019779

Gene Name

fyn-related kinase

Synonyms

GTK, BSK/IYK

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34483399-34611278 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34591938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 316 (M316K)

Ref Sequence

ENSEMBL: ENSMUSP00000019913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]

AlphaFold

Q922K9

PDB Structure

Solution structure of the SH3 domain of Fyn-related kinase [SOLUTION NMR]
Solution structure of the SH2 domain of murine Fyn-related kinase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019913
AA Change: M316K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: M316K

Domain	Start	End	E-Value	Type
SH3	52	116	2.76e-19	SMART
SH2	121	206	4.97e-37	SMART
TyrKc	241	494	8.58e-137	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170771
AA Change: M316K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: M316K

Domain	Start	End	E-Value	Type
SH3	52	116	2.76e-19	SMART
SH2	121	206	4.97e-37	SMART
TyrKc	241	494	8.58e-137	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Frk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Frk	APN	10	34484243	missense	probably damaging	0.98
IGL01402:Frk	APN	10	34547385	missense	probably damaging	1.00
IGL02197:Frk	APN	10	34484334	missense	probably damaging	1.00
IGL02289:Frk	APN	10	34484366	missense	probably damaging	0.99
IGL02618:Frk	APN	10	34583964	missense	possibly damaging	0.88
IGL02885:Frk	APN	10	34484071	missense	probably benign	0.03
IGL03256:Frk	APN	10	34607842	missense	probably benign	0.00
R0299:Frk	UTSW	10	34484371	critical splice donor site	probably null
R0697:Frk	UTSW	10	34607837	missense	probably benign	0.12
R1033:Frk	UTSW	10	34608458	missense	probably damaging	1.00
R1583:Frk	UTSW	10	34591810	critical splice acceptor site	probably null
R1793:Frk	UTSW	10	34607882	missense	probably benign	0.05
R2248:Frk	UTSW	10	34608531	missense	probably benign	0.10
R3084:Frk	UTSW	10	34607954	missense	probably damaging	1.00
R3086:Frk	UTSW	10	34607954	missense	probably damaging	1.00
R3765:Frk	UTSW	10	34484005	start codon destroyed	probably null	0.98
R3766:Frk	UTSW	10	34484005	start codon destroyed	probably null	0.98
R3906:Frk	UTSW	10	34584056	missense	probably benign	0.00
R4163:Frk	UTSW	10	34591872	missense	probably damaging	0.98
R4486:Frk	UTSW	10	34608381	missense	probably benign	0.10
R4591:Frk	UTSW	10	34605833	missense	probably benign	0.03
R4821:Frk	UTSW	10	34484237	missense	probably benign	0.01
R5070:Frk	UTSW	10	34484284	nonsense	probably null
R6172:Frk	UTSW	10	34591965	missense	probably damaging	1.00
R6572:Frk	UTSW	10	34583967	missense	probably benign	0.00
R6619:Frk	UTSW	10	34605839	missense	probably benign	0.22
R7486:Frk	UTSW	10	34547296	nonsense	probably null
R7916:Frk	UTSW	10	34484025	missense	possibly damaging	0.74
R8341:Frk	UTSW	10	34586283	missense	probably damaging	1.00
R8675:Frk	UTSW	10	34608497	missense	probably benign	0.00
R8801:Frk	UTSW	10	34547406	missense	possibly damaging	0.78
R9608:Frk	UTSW	10	34605877	critical splice donor site	probably null
Z1177:Frk	UTSW	10	34584005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGAGGCAATCATGGTGTTTC -3'
(R):5'- TAGTAGTTGAGCTGGTCATGTTAAC -3'

Sequencing Primer
(F):5'- CTGTGGGGATAGGAATGCCTCAG -3'
(R):5'- GAGCTGGTCATGTTAACATTCATTC -3'

Posted On

2019-06-26