Incidental Mutation 'R7307:Frk'
ID567323
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Namefyn-related kinase
SynonymsGTK, BSK/IYK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location34483399-34611278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34591938 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 316 (M316K)
Ref Sequence ENSEMBL: ENSMUSP00000019913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
PDB Structure
Solution structure of the SH3 domain of Fyn-related kinase [SOLUTION NMR]
Solution structure of the SH2 domain of murine Fyn-related kinase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000019913
AA Change: M316K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: M316K

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170771
AA Change: M316K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: M316K

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34484243 missense probably damaging 0.98
IGL01402:Frk APN 10 34547385 missense probably damaging 1.00
IGL02197:Frk APN 10 34484334 missense probably damaging 1.00
IGL02289:Frk APN 10 34484366 missense probably damaging 0.99
IGL02618:Frk APN 10 34583964 missense possibly damaging 0.88
IGL02885:Frk APN 10 34484071 missense probably benign 0.03
IGL03256:Frk APN 10 34607842 missense probably benign 0.00
R0299:Frk UTSW 10 34484371 critical splice donor site probably null
R0697:Frk UTSW 10 34607837 missense probably benign 0.12
R1033:Frk UTSW 10 34608458 missense probably damaging 1.00
R1583:Frk UTSW 10 34591810 critical splice acceptor site probably null
R1793:Frk UTSW 10 34607882 missense probably benign 0.05
R2248:Frk UTSW 10 34608531 missense probably benign 0.10
R3084:Frk UTSW 10 34607954 missense probably damaging 1.00
R3086:Frk UTSW 10 34607954 missense probably damaging 1.00
R3765:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3766:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3906:Frk UTSW 10 34584056 missense probably benign 0.00
R4163:Frk UTSW 10 34591872 missense probably damaging 0.98
R4486:Frk UTSW 10 34608381 missense probably benign 0.10
R4591:Frk UTSW 10 34605833 missense probably benign 0.03
R4821:Frk UTSW 10 34484237 missense probably benign 0.01
R5070:Frk UTSW 10 34484284 nonsense probably null
R6172:Frk UTSW 10 34591965 missense probably damaging 1.00
R6572:Frk UTSW 10 34583967 missense probably benign 0.00
R6619:Frk UTSW 10 34605839 missense probably benign 0.22
R7486:Frk UTSW 10 34547296 nonsense probably null
R7916:Frk UTSW 10 34484025 missense possibly damaging 0.74
R8341:Frk UTSW 10 34586283 missense probably damaging 1.00
Z1177:Frk UTSW 10 34584005 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAGGCAATCATGGTGTTTC -3'
(R):5'- TAGTAGTTGAGCTGGTCATGTTAAC -3'

Sequencing Primer
(F):5'- CTGTGGGGATAGGAATGCCTCAG -3'
(R):5'- GAGCTGGTCATGTTAACATTCATTC -3'
Posted On2019-06-26