Mutagenetix > Incidental Mutations

Incidental Mutation 'R7307:Arhgap45'

567325

Institutional Source

Beutler Lab

Gene Symbol

Arhgap45

Ensembl Gene

ENSMUSG00000035697

Gene Name

Rho GTPase activating protein 45

Synonyms

6330406L22Rik, Hmha1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80016653-80031472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80029182 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 993 (Q993R)

Ref Sequence

ENSEMBL: ENSMUSP00000101012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043311
AA Change: Q866R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: Q866R

Domain	Start	End	E-Value	Type
low complexity region	142	153	N/A	INTRINSIC
FCH	157	244	4.14e-17	SMART
low complexity region	255	269	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	330	345	N/A	INTRINSIC
low complexity region	527	536	N/A	INTRINSIC
C1	582	628	3.15e-8	SMART
RhoGAP	653	852	2.73e-73	SMART
low complexity region	856	869	N/A	INTRINSIC
Blast:RhoGAP	876	999	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099501
AA Change: Q982R

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: Q982R

Domain	Start	End	E-Value	Type
low complexity region	258	269	N/A	INTRINSIC
FCH	273	360	4.14e-17	SMART
low complexity region	371	385	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	446	461	N/A	INTRINSIC
low complexity region	643	652	N/A	INTRINSIC
C1	698	744	3.15e-8	SMART
RhoGAP	769	968	2.73e-73	SMART
low complexity region	972	985	N/A	INTRINSIC
Blast:RhoGAP	992	1115	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105373
AA Change: Q993R

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: Q993R

Domain	Start	End	E-Value	Type
low complexity region	269	280	N/A	INTRINSIC
FCH	284	371	4.14e-17	SMART
low complexity region	382	396	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	457	472	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
C1	709	755	3.15e-8	SMART
RhoGAP	780	979	2.73e-73	SMART
low complexity region	983	996	N/A	INTRINSIC
Blast:RhoGAP	1003	1126	1e-21	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Arhgap45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Arhgap45	APN	10	80028648	splice site	probably benign
IGL01414:Arhgap45	APN	10	80027104	missense	probably damaging	1.00
IGL01505:Arhgap45	APN	10	80026542	missense	probably benign	0.10
IGL02203:Arhgap45	APN	10	80027553	nonsense	probably null
IGL02557:Arhgap45	APN	10	80021638	missense	probably damaging	1.00
IGL02858:Arhgap45	APN	10	80017934	missense	probably benign	0.20
IGL03292:Arhgap45	APN	10	80020969	missense	probably benign	0.04
IGL03352:Arhgap45	APN	10	80030751	missense	probably damaging	0.96
Celt	UTSW	10	80020818	missense	probably damaging	1.00
celtic	UTSW	10	80027589	nonsense	probably null
druid	UTSW	10	80026347	critical splice donor site	probably null
Mistletoe	UTSW	10	80027102	nonsense	probably null
Roman	UTSW	10	80027597	missense	probably damaging	1.00
stonehenge	UTSW	10	80025482	missense	possibly damaging	0.81
IGL03048:Arhgap45	UTSW	10	80017017	missense	probably damaging	0.99
PIT4677001:Arhgap45	UTSW	10	80020749	missense	probably benign
R0532:Arhgap45	UTSW	10	80022083	missense	possibly damaging	0.92
R1233:Arhgap45	UTSW	10	80027582	missense	probably damaging	1.00
R1579:Arhgap45	UTSW	10	80028977	missense	probably damaging	1.00
R1666:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1668:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1688:Arhgap45	UTSW	10	80029095	missense	probably damaging	1.00
R1710:Arhgap45	UTSW	10	80018098	nonsense	probably null
R1902:Arhgap45	UTSW	10	80025466	missense	probably damaging	0.99
R1912:Arhgap45	UTSW	10	80020690	missense	probably benign	0.08
R1935:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1936:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1955:Arhgap45	UTSW	10	80026492	missense	probably benign	0.15
R1968:Arhgap45	UTSW	10	80027702	missense	probably damaging	1.00
R1977:Arhgap45	UTSW	10	80020818	missense	probably damaging	1.00
R1986:Arhgap45	UTSW	10	80020696	missense	probably damaging	1.00
R2074:Arhgap45	UTSW	10	80027180	missense	probably damaging	1.00
R2081:Arhgap45	UTSW	10	80027674	missense	probably damaging	1.00
R2162:Arhgap45	UTSW	10	80016979	start codon destroyed	probably null	0.02
R2937:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R2938:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R3081:Arhgap45	UTSW	10	80026447	missense	probably damaging	1.00
R4695:Arhgap45	UTSW	10	80025530	missense	probably damaging	1.00
R4736:Arhgap45	UTSW	10	80026172	missense	probably damaging	1.00
R4758:Arhgap45	UTSW	10	80030293	missense	probably benign	0.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4934:Arhgap45	UTSW	10	80020957	missense	probably damaging	1.00
R4943:Arhgap45	UTSW	10	80026503	missense	probably benign	0.00
R5102:Arhgap45	UTSW	10	80021428	missense	probably benign	0.01
R5128:Arhgap45	UTSW	10	80030959	missense	probably benign	0.16
R5667:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5671:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5920:Arhgap45	UTSW	10	80029131	missense	possibly damaging	0.87
R5998:Arhgap45	UTSW	10	80030950	missense	probably damaging	0.99
R6276:Arhgap45	UTSW	10	80026234	missense	probably benign	0.25
R6675:Arhgap45	UTSW	10	80018104	missense	probably null	0.98
R6738:Arhgap45	UTSW	10	80027597	missense	probably damaging	1.00
R6783:Arhgap45	UTSW	10	80017864	missense	possibly damaging	0.92
R6863:Arhgap45	UTSW	10	80017782	missense	probably benign	0.03
R6978:Arhgap45	UTSW	10	80021848	missense	probably benign	0.00
R7089:Arhgap45	UTSW	10	80026347	critical splice donor site	probably null
R7215:Arhgap45	UTSW	10	80025482	missense	possibly damaging	0.81
R7308:Arhgap45	UTSW	10	80026558	critical splice donor site	probably null
R7480:Arhgap45	UTSW	10	80027102	nonsense	probably null
R7481:Arhgap45	UTSW	10	80022300	missense	possibly damaging	0.80
R7649:Arhgap45	UTSW	10	80031001	missense	probably benign	0.00
R7652:Arhgap45	UTSW	10	80028838	missense	probably benign	0.01
R7748:Arhgap45	UTSW	10	80016932	unclassified	probably benign
R7883:Arhgap45	UTSW	10	80027589	nonsense	probably null
R8121:Arhgap45	UTSW	10	80018075	missense	probably damaging	0.99
R8687:Arhgap45	UTSW	10	80016787	unclassified	probably benign
R8866:Arhgap45	UTSW	10	80017916	missense	probably damaging	1.00
R8905:Arhgap45	UTSW	10	80019736	missense	probably benign	0.00
X0023:Arhgap45	UTSW	10	80030800	missense	probably damaging	0.98
X0063:Arhgap45	UTSW	10	80030356	missense	possibly damaging	0.51
Z1176:Arhgap45	UTSW	10	80025536	missense	probably damaging	1.00
Z1176:Arhgap45	UTSW	10	80029052	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACCTGGGCATCGTTTTCG -3'
(R):5'- CCAGAAACTTCTCCGTGGG -3'

Sequencing Primer
(F):5'- TTCGGGCCCACACTGTTG -3'
(R):5'- CATAAGGTTCTCATGTAGCCCAGG -3'

Posted On

2019-06-26