Incidental Mutation 'R7307:Arhgap45'
ID567325
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80029182 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 993 (Q993R)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
Predicted Effect probably benign
Transcript: ENSMUST00000043311
AA Change: Q866R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: Q866R

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000099501
AA Change: Q982R

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: Q982R

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105373
AA Change: Q993R

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: Q993R

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
celtic UTSW 10 80027589 nonsense probably null
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 80018098 nonsense probably null
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5128:Arhgap45 UTSW 10 80030959 missense probably benign 0.16
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R6978:Arhgap45 UTSW 10 80021848 missense probably benign 0.00
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7652:Arhgap45 UTSW 10 80028838 missense probably benign 0.01
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7883:Arhgap45 UTSW 10 80027589 nonsense probably null
R8121:Arhgap45 UTSW 10 80018075 missense probably damaging 0.99
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536 missense probably damaging 1.00
Z1176:Arhgap45 UTSW 10 80029052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTGGGCATCGTTTTCG -3'
(R):5'- CCAGAAACTTCTCCGTGGG -3'

Sequencing Primer
(F):5'- TTCGGGCCCACACTGTTG -3'
(R):5'- CATAAGGTTCTCATGTAGCCCAGG -3'
Posted On2019-06-26