Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Pitpnm3'

567327

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm3

Ensembl Gene

ENSMUSG00000040543

Gene Name

PITPNM family member 3

Synonyms

Ackr6, A330068P14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72047528-72135778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 72070964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 275 (A275D)

Ref Sequence

ENSEMBL: ENSMUSP00000074737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]

AlphaFold

Q3UHE1

Predicted Effect

probably damaging
Transcript: ENSMUST00000075258
AA Change: A275D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: A275D

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
Blast:DDHD	141	361	1e-105	BLAST
DDHD	390	594	1.49e-91	SMART
LNS2	739	870	2.12e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108508
AA Change: A259D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: A259D

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
Blast:DDHD	125	345	1e-106	BLAST
DDHD	374	578	1.49e-91	SMART
LNS2	723	854	2.12e-55	SMART

Meta Mutation Damage Score

0.5057

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Pitpnm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01818:Pitpnm3	APN	11	72112251	splice site	probably benign
IGL01871:Pitpnm3	APN	11	72056138	missense	probably damaging	0.99
IGL02058:Pitpnm3	APN	11	72120139	missense	probably benign	0.31
IGL02267:Pitpnm3	APN	11	72071448	missense	probably benign	0.02
IGL02370:Pitpnm3	APN	11	72051858	missense	probably benign	0.04
IGL02613:Pitpnm3	APN	11	72058072	missense	probably damaging	1.00
IGL02835:Pitpnm3	APN	11	72061466	splice site	probably benign
IGL02946:Pitpnm3	APN	11	72092552	missense	probably benign	0.08
IGL02989:Pitpnm3	APN	11	72120186	splice site	probably benign
IGL03173:Pitpnm3	APN	11	72092563	missense	probably benign	0.02
IGL03357:Pitpnm3	APN	11	72070890	nonsense	probably null
Frank	UTSW	11	72070396	missense	probably benign
Mickey	UTSW	11	72070964	missense	probably damaging	1.00
Stuart	UTSW	11	72051929	missense	probably null	0.99
R0102:Pitpnm3	UTSW	11	72056246	missense	probably damaging	1.00
R0193:Pitpnm3	UTSW	11	72070492	splice site	probably benign
R0964:Pitpnm3	UTSW	11	72058470	missense	probably damaging	1.00
R1475:Pitpnm3	UTSW	11	72074627	missense	probably damaging	1.00
R1566:Pitpnm3	UTSW	11	72058959	splice site	probably null
R1951:Pitpnm3	UTSW	11	72074624	missense	possibly damaging	0.88
R3915:Pitpnm3	UTSW	11	72112284	missense	probably damaging	1.00
R4192:Pitpnm3	UTSW	11	72051959	missense	possibly damaging	0.96
R4278:Pitpnm3	UTSW	11	72074516	missense	probably damaging	1.00
R4928:Pitpnm3	UTSW	11	72063172	missense	probably damaging	1.00
R5543:Pitpnm3	UTSW	11	72056197	missense	probably damaging	0.99
R5626:Pitpnm3	UTSW	11	72112332	missense	probably benign	0.04
R5635:Pitpnm3	UTSW	11	72067160	missense	possibly damaging	0.95
R5958:Pitpnm3	UTSW	11	72112367	splice site	probably null
R6531:Pitpnm3	UTSW	11	72071487	missense	possibly damaging	0.94
R6634:Pitpnm3	UTSW	11	72051929	missense	probably null	0.99
R6764:Pitpnm3	UTSW	11	72051233	missense	probably damaging	1.00
R6912:Pitpnm3	UTSW	11	72070396	missense	probably benign
R7132:Pitpnm3	UTSW	11	72051276	missense	possibly damaging	0.86
R7561:Pitpnm3	UTSW	11	72051182	missense	probably benign	0.02
R7771:Pitpnm3	UTSW	11	72061488	nonsense	probably null
R8099:Pitpnm3	UTSW	11	72070318	missense	possibly damaging	0.85
R8753:Pitpnm3	UTSW	11	72051878	missense	probably benign	0.01
R8817:Pitpnm3	UTSW	11	72051068	missense	possibly damaging	0.74
R8987:Pitpnm3	UTSW	11	72112306	missense	probably damaging	1.00
R9054:Pitpnm3	UTSW	11	72056191	missense	probably damaging	0.97
R9450:Pitpnm3	UTSW	11	72061586	missense	possibly damaging	0.50
R9508:Pitpnm3	UTSW	11	72112295	missense	probably damaging	1.00
R9606:Pitpnm3	UTSW	11	72064243	missense	probably benign	0.02
R9740:Pitpnm3	UTSW	11	72056276	missense	probably benign	0.34
X0018:Pitpnm3	UTSW	11	72071440	missense	probably benign	0.42
X0062:Pitpnm3	UTSW	11	72067108	missense	probably damaging	1.00
Z1186:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1186:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72120143	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAATGCCAACACGAGTGCC -3'
(R):5'- TCTATTGTCAAGATGAGCCTACC -3'

Sequencing Primer
(F):5'- AGTGCCTGGAACGACCTTC -3'
(R):5'- AAGATGAGCCTACCCTCCATTTGTG -3'

Posted On

2019-06-26