Incidental Mutation 'R0637:Hivep3'
ID56733
Institutional Source Beutler Lab
Gene Symbol Hivep3
Ensembl Gene ENSMUSG00000028634
Gene Namehuman immunodeficiency virus type I enhancer binding protein 3
SynonymsE030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0637 (G1)
Quality Score194
Status Validated
Chromosome4
Chromosomal Location119733784-120138045 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 120132541 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 2063 (L2063*)
Ref Sequence ENSEMBL: ENSMUSP00000130249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542]
Predicted Effect probably null
Transcript: ENSMUST00000106307
AA Change: L2063*
SMART Domains Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: L2063*

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166542
AA Change: L2063*
SMART Domains Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: L2063*

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Hivep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Hivep3 APN 4 120098374 missense probably damaging 1.00
IGL01017:Hivep3 APN 4 120099246 missense probably damaging 0.98
IGL01837:Hivep3 APN 4 120094562 missense possibly damaging 0.72
IGL01878:Hivep3 APN 4 120095227 missense possibly damaging 0.84
IGL02134:Hivep3 APN 4 120133574 splice site probably benign
IGL02183:Hivep3 APN 4 120132024 missense probably benign 0.04
IGL02350:Hivep3 APN 4 120123025 missense probably damaging 1.00
IGL02451:Hivep3 APN 4 120133965 missense probably damaging 1.00
IGL02567:Hivep3 APN 4 120133956 missense probably damaging 0.99
IGL02617:Hivep3 APN 4 120095444 missense probably benign 0.04
IGL02725:Hivep3 APN 4 120095822 missense possibly damaging 0.48
IGL02828:Hivep3 APN 4 120097732 nonsense probably null
IGL02954:Hivep3 APN 4 120133641 missense probably damaging 1.00
IGL02966:Hivep3 APN 4 120132186 missense probably benign 0.04
Deceit UTSW 4 120097911 frame shift probably null
Stealth UTSW 4 120122876 nonsense probably null
PIT4260001:Hivep3 UTSW 4 120099182 missense probably damaging 1.00
R0321:Hivep3 UTSW 4 120095591 missense possibly damaging 0.84
R0336:Hivep3 UTSW 4 120103847 missense probably damaging 1.00
R0558:Hivep3 UTSW 4 120096566 missense probably damaging 0.98
R0562:Hivep3 UTSW 4 120096554 missense probably benign 0.00
R0645:Hivep3 UTSW 4 120097334 missense possibly damaging 0.95
R1186:Hivep3 UTSW 4 119814723 start gained probably benign
R1254:Hivep3 UTSW 4 120099293 missense probably damaging 1.00
R1428:Hivep3 UTSW 4 120096575 missense possibly damaging 0.92
R1623:Hivep3 UTSW 4 120095704 missense possibly damaging 0.84
R1739:Hivep3 UTSW 4 120095174 missense probably benign 0.03
R1766:Hivep3 UTSW 4 120096671 missense probably benign
R1769:Hivep3 UTSW 4 120097571 missense possibly damaging 0.68
R1773:Hivep3 UTSW 4 120098837 missense probably damaging 1.00
R1968:Hivep3 UTSW 4 120096238 missense possibly damaging 0.83
R2220:Hivep3 UTSW 4 119734038 missense possibly damaging 0.92
R2428:Hivep3 UTSW 4 120098508 nonsense probably null
R3789:Hivep3 UTSW 4 120098416 missense probably damaging 1.00
R3917:Hivep3 UTSW 4 120099427 missense probably benign 0.27
R4366:Hivep3 UTSW 4 120096089 missense possibly damaging 0.84
R4436:Hivep3 UTSW 4 120095923 missense probably benign 0.11
R4504:Hivep3 UTSW 4 119733793 unclassified probably benign
R4705:Hivep3 UTSW 4 119872050 intron probably benign
R4713:Hivep3 UTSW 4 120131803 missense probably damaging 1.00
R4756:Hivep3 UTSW 4 120097823 missense probably damaging 0.98
R4887:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R4888:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R5008:Hivep3 UTSW 4 120098917 missense probably benign 0.22
R5204:Hivep3 UTSW 4 120103856 critical splice donor site probably null
R5594:Hivep3 UTSW 4 120123048 critical splice donor site probably null
R5697:Hivep3 UTSW 4 120096955 missense possibly damaging 0.68
R5715:Hivep3 UTSW 4 120096373 missense probably benign
R5740:Hivep3 UTSW 4 120096023 missense possibly damaging 0.83
R5760:Hivep3 UTSW 4 120095011 missense possibly damaging 0.83
R5923:Hivep3 UTSW 4 120096293 missense possibly damaging 0.92
R5927:Hivep3 UTSW 4 120097108 missense possibly damaging 0.68
R6042:Hivep3 UTSW 4 120097864 missense possibly damaging 0.85
R6074:Hivep3 UTSW 4 120097694 missense possibly damaging 0.68
R6150:Hivep3 UTSW 4 119734077 nonsense probably null
R6211:Hivep3 UTSW 4 120098405 missense probably damaging 1.00
R6251:Hivep3 UTSW 4 120094940 missense probably damaging 0.98
R6451:Hivep3 UTSW 4 120098908 missense probably benign 0.22
R6531:Hivep3 UTSW 4 120122876 nonsense probably null
R6651:Hivep3 UTSW 4 120122949 missense probably damaging 1.00
R6701:Hivep3 UTSW 4 120094540 missense probably damaging 0.97
R6721:Hivep3 UTSW 4 120095099 missense possibly damaging 0.82
R6796:Hivep3 UTSW 4 120096361 missense possibly damaging 0.68
R6864:Hivep3 UTSW 4 120094888 missense possibly damaging 0.48
R6902:Hivep3 UTSW 4 120095995 missense possibly damaging 0.48
R7111:Hivep3 UTSW 4 120095234 missense possibly damaging 0.68
R7113:Hivep3 UTSW 4 120098369 missense probably damaging 1.00
R7140:Hivep3 UTSW 4 120097121 missense probably damaging 0.99
R7189:Hivep3 UTSW 4 120132219 missense probably damaging 0.99
R7218:Hivep3 UTSW 4 120095452 missense possibly damaging 0.92
R7366:Hivep3 UTSW 4 120097911 frame shift probably null
R7368:Hivep3 UTSW 4 120097911 frame shift probably null
R7491:Hivep3 UTSW 4 120098830 missense probably benign 0.09
R7496:Hivep3 UTSW 4 120132402 missense probably benign 0.00
R7514:Hivep3 UTSW 4 120096855 missense possibly damaging 0.48
R7604:Hivep3 UTSW 4 120097911 frame shift probably null
R7605:Hivep3 UTSW 4 120097911 frame shift probably null
R7607:Hivep3 UTSW 4 120097911 frame shift probably null
R7610:Hivep3 UTSW 4 120097911 frame shift probably null
R7611:Hivep3 UTSW 4 120097911 frame shift probably null
R7613:Hivep3 UTSW 4 120097911 frame shift probably null
R7626:Hivep3 UTSW 4 120097911 frame shift probably null
R7707:Hivep3 UTSW 4 119733959 missense
R7736:Hivep3 UTSW 4 120095543 missense possibly damaging 0.92
RF019:Hivep3 UTSW 4 120098270 missense probably benign 0.12
X0062:Hivep3 UTSW 4 120098698 missense probably damaging 1.00
X0067:Hivep3 UTSW 4 120131787 missense probably damaging 0.96
Z1176:Hivep3 UTSW 4 120133782 missense probably damaging 1.00
Z1177:Hivep3 UTSW 4 120095946 missense possibly damaging 0.68
Z1177:Hivep3 UTSW 4 120131778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGACTGGAGCTGTCCTGTCTCAC -3'
(R):5'- AGCTTGCCACATGCCCAGGAATAC -3'

Sequencing Primer
(F):5'- CTACCCCATAGGAAGAGAAGCG -3'
(R):5'- AATACCGGCCTGGCTCTG -3'
Posted On2013-07-11