Incidental Mutation 'R7307:Ddx1'
ID567332
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13223959 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 581 (I581N)
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103]
Predicted Effect probably damaging
Transcript: ENSMUST00000071103
AA Change: I581N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: I581N

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTGACGGTACCTTTCAGC -3'
(R):5'- TTAATGTCATCTCAGCAGACCATAG -3'

Sequencing Primer
(F):5'- GACGGTACCTTTCAGCTCGTC -3'
(R):5'- GAGTAAAATTTCAGGATTTGGTGCAG -3'
Posted On2019-06-26