Incidental Mutation 'R7307:Lrit2'
ID567340
Institutional Source Beutler Lab
Gene Symbol Lrit2
Ensembl Gene ENSMUSG00000043418
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 2
SynonymsA930010E21Rik, Lrrc22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location37067929-37073743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37072199 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 407 (K407E)
Ref Sequence ENSEMBL: ENSMUSP00000056642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057176]
Predicted Effect probably benign
Transcript: ENSMUST00000057176
AA Change: K407E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056642
Gene: ENSMUSG00000043418
AA Change: K407E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 23 59 7.74e-2 SMART
LRR 78 101 9.96e-1 SMART
LRR_TYP 102 125 8.94e-3 SMART
LRR 126 149 2.03e1 SMART
LRR_TYP 150 173 7.67e-2 SMART
LRRCT 200 251 7.12e-7 SMART
IGc2 265 334 2.05e-9 SMART
FN3 362 443 5.94e0 SMART
transmembrane domain 463 485 N/A INTRINSIC
low complexity region 538 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Lrit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lrit2 APN 14 37071963 missense probably benign 0.31
IGL01475:Lrit2 APN 14 37069094 missense probably damaging 1.00
IGL02080:Lrit2 APN 14 37069074 missense probably damaging 0.99
IGL02141:Lrit2 APN 14 37068074 unclassified probably benign
IGL02479:Lrit2 APN 14 37072278 missense probably damaging 0.99
IGL02715:Lrit2 APN 14 37072548 missense probably benign 0.00
R0114:Lrit2 UTSW 14 37068045 splice site probably null
R1344:Lrit2 UTSW 14 37068556 missense probably benign 0.32
R1529:Lrit2 UTSW 14 37068827 missense probably benign 0.12
R1641:Lrit2 UTSW 14 37069148 missense probably benign 0.34
R2105:Lrit2 UTSW 14 37071956 missense probably damaging 1.00
R4365:Lrit2 UTSW 14 37072119 missense probably damaging 1.00
R4645:Lrit2 UTSW 14 37072475 missense probably benign
R5226:Lrit2 UTSW 14 37072353 missense probably damaging 1.00
R5377:Lrit2 UTSW 14 37069183 missense possibly damaging 0.59
R5387:Lrit2 UTSW 14 37072259 missense probably damaging 1.00
R5840:Lrit2 UTSW 14 37069005 missense possibly damaging 0.64
R5881:Lrit2 UTSW 14 37072235 missense probably benign 0.02
R6499:Lrit2 UTSW 14 37068810 missense probably damaging 0.98
R6863:Lrit2 UTSW 14 37071944 missense probably damaging 0.99
R7316:Lrit2 UTSW 14 37068858 missense probably damaging 1.00
R7491:Lrit2 UTSW 14 37068910 missense possibly damaging 0.83
R7525:Lrit2 UTSW 14 37072493 missense possibly damaging 0.76
R7640:Lrit2 UTSW 14 37072124 missense probably damaging 1.00
R8228:Lrit2 UTSW 14 37069191 missense probably damaging 1.00
R8397:Lrit2 UTSW 14 37069077 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAGCTCCCTTGTCATCTTAC -3'
(R):5'- CTACAGTGACATGCAAGAGGTG -3'

Sequencing Primer
(F):5'- CTATGTCCAGCCTGCACAG -3'
(R):5'- AGAGGTGCTCACGACCCTCTAG -3'
Posted On2019-06-26