Incidental Mutation 'R7307:Zc3h13'
ID 567341
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Name zinc finger CCCH type containing 13
Synonyms 3110050K21Rik, C87618, 4930570G11Rik, 2600010B19Rik
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 75521813-75581866 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75567981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1091 (D1091E)
Ref Sequence ENSEMBL: ENSMUSP00000022577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold E9Q784
Predicted Effect probably damaging
Transcript: ENSMUST00000022577
AA Change: D1091E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: D1091E

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: D1091E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2b T C 7: 30,279,896 (GRCm39) H1368R probably damaging Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75,567,587 (GRCm39) missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75,573,439 (GRCm39) missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75,547,163 (GRCm39) missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75,581,209 (GRCm39) utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75,567,787 (GRCm39) missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75,569,206 (GRCm39) missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75,531,381 (GRCm39) missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75,531,416 (GRCm39) missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75,553,479 (GRCm39) missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75,561,050 (GRCm39) small insertion probably benign
FR4304:Zc3h13 UTSW 14 75,561,043 (GRCm39) small insertion probably benign
FR4340:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4449:Zc3h13 UTSW 14 75,561,041 (GRCm39) nonsense probably null
FR4548:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,038 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,037 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,036 (GRCm39) small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75,569,323 (GRCm39) missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75,560,694 (GRCm39) missense unknown
R0374:Zc3h13 UTSW 14 75,546,405 (GRCm39) missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75,560,922 (GRCm39) missense unknown
R0408:Zc3h13 UTSW 14 75,529,626 (GRCm39) nonsense probably null
R0967:Zc3h13 UTSW 14 75,581,179 (GRCm39) missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75,553,424 (GRCm39) missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75,574,923 (GRCm39) nonsense probably null
R2021:Zc3h13 UTSW 14 75,567,635 (GRCm39) missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75,569,587 (GRCm39) missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75,546,380 (GRCm39) nonsense probably null
R3745:Zc3h13 UTSW 14 75,568,101 (GRCm39) missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75,567,178 (GRCm39) missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75,565,041 (GRCm39) missense unknown
R4799:Zc3h13 UTSW 14 75,576,863 (GRCm39) missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75,576,836 (GRCm39) missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75,573,449 (GRCm39) missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75,581,059 (GRCm39) missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75,568,687 (GRCm39) missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75,568,348 (GRCm39) missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75,569,400 (GRCm39) nonsense probably null
R5726:Zc3h13 UTSW 14 75,568,269 (GRCm39) missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75,565,572 (GRCm39) missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75,568,149 (GRCm39) missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75,574,849 (GRCm39) missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75,581,176 (GRCm39) missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75,567,863 (GRCm39) missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75,546,355 (GRCm39) missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75,560,998 (GRCm39) small deletion probably benign
R6598:Zc3h13 UTSW 14 75,569,623 (GRCm39) missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75,568,597 (GRCm39) missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75,559,227 (GRCm39) missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75,559,161 (GRCm39) missense unknown
R7515:Zc3h13 UTSW 14 75,546,349 (GRCm39) missense unknown
R7680:Zc3h13 UTSW 14 75,567,955 (GRCm39) missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75,568,070 (GRCm39) missense not run
R8048:Zc3h13 UTSW 14 75,561,977 (GRCm39) missense unknown
R8059:Zc3h13 UTSW 14 75,565,250 (GRCm39) missense unknown
R8362:Zc3h13 UTSW 14 75,561,909 (GRCm39) missense unknown
R8391:Zc3h13 UTSW 14 75,568,625 (GRCm39) missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75,569,512 (GRCm39) missense probably benign 0.05
R9081:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9082:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9101:Zc3h13 UTSW 14 75,561,042 (GRCm39) missense unknown
R9214:Zc3h13 UTSW 14 75,560,991 (GRCm39) missense unknown
R9308:Zc3h13 UTSW 14 75,565,418 (GRCm39) missense unknown
R9376:Zc3h13 UTSW 14 75,561,128 (GRCm39) missense unknown
R9618:Zc3h13 UTSW 14 75,567,542 (GRCm39) missense
R9665:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
Z1177:Zc3h13 UTSW 14 75,565,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTTGTGGCGACAGG -3'
(R):5'- GTCAGGCACATCCTCATCAG -3'

Sequencing Primer
(F):5'- GTCTGATCGAGCCCATGATG -3'
(R):5'- GACCAGTCACTAAAGGCTGTATTTTC -3'
Posted On 2019-06-26