Incidental Mutation 'R7307:Arhgef33'
ID567352
Institutional Source Beutler Lab
Gene Symbol Arhgef33
Ensembl Gene ENSMUSG00000054901
Gene NameRho guanine nucleotide exchange factor (GEF) 33
SynonymsLOC381112, Gm941
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80307407-80400081 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to C at 80347120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068175] [ENSMUST00000068175] [ENSMUST00000223878] [ENSMUST00000223878] [ENSMUST00000224391] [ENSMUST00000224391]
Predicted Effect probably null
Transcript: ENSMUST00000068175
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068175
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223878
Predicted Effect probably null
Transcript: ENSMUST00000223878
Predicted Effect probably null
Transcript: ENSMUST00000224391
Predicted Effect probably null
Transcript: ENSMUST00000224391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Arhgef33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL00784:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL01601:Arhgef33 APN 17 80347683 missense probably damaging 1.00
IGL01647:Arhgef33 APN 17 80365266 splice site probably benign
IGL02654:Arhgef33 APN 17 80370311 missense probably damaging 1.00
IGL02712:Arhgef33 APN 17 80360373 missense probably damaging 1.00
R0195:Arhgef33 UTSW 17 80381434 missense probably damaging 0.96
R0732:Arhgef33 UTSW 17 80381354 missense possibly damaging 0.90
R0834:Arhgef33 UTSW 17 80347597 splice site probably benign
R1144:Arhgef33 UTSW 17 80355044 missense probably benign
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1513:Arhgef33 UTSW 17 80371389 missense probably benign
R1680:Arhgef33 UTSW 17 80347651 missense probably damaging 0.96
R1696:Arhgef33 UTSW 17 80349506 missense probably damaging 1.00
R1775:Arhgef33 UTSW 17 80373743 missense probably benign 0.05
R2046:Arhgef33 UTSW 17 80373466 missense probably benign 0.08
R3933:Arhgef33 UTSW 17 80373320 missense probably benign 0.01
R4573:Arhgef33 UTSW 17 80365282 missense probably damaging 1.00
R5222:Arhgef33 UTSW 17 80337314 missense probably damaging 1.00
R5269:Arhgef33 UTSW 17 80370275 missense probably damaging 1.00
R5933:Arhgef33 UTSW 17 80337280 missense probably benign
R6460:Arhgef33 UTSW 17 80349589 splice site probably null
R7594:Arhgef33 UTSW 17 80370305 missense probably damaging 1.00
R7746:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7895:Arhgef33 UTSW 17 80373485 missense probably benign 0.00
R7956:Arhgef33 UTSW 17 80355048 missense possibly damaging 0.81
R8508:Arhgef33 UTSW 17 80367335 missense probably damaging 1.00
Z1177:Arhgef33 UTSW 17 80384230 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTCAAGCTTCAGTGCAC -3'
(R):5'- GGAAATAAGAGAGGCTCCCACC -3'

Sequencing Primer
(F):5'- ACCTCTGCCCTGGACGAATAG -3'
(R):5'- GGCTCCCACCTTGAAGTAGTTTAATG -3'
Posted On2019-06-26