Incidental Mutation 'R7307:Malt1'
ID 567355
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene Name MALT1 paracaspase
Synonyms paracaspase, D430033E09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 65430962-65478823 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65451569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 325 (H325Q)
Ref Sequence ENSEMBL: ENSMUSP00000048376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
AlphaFold Q2TBA3
Predicted Effect possibly damaging
Transcript: ENSMUST00000049248
AA Change: H325Q

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: H325Q

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224056
AA Change: H336Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Zdhhc6 A G 19: 55,313,250 Y100H probably damaging Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
frappe UTSW 18 65473119 missense probably benign 0.01
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7184:Malt1 UTSW 18 65447693 missense probably benign
R7192:Malt1 UTSW 18 65437827 missense probably benign 0.07
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7558:Malt1 UTSW 18 65462834 missense probably damaging 1.00
R7756:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7758:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7892:Malt1 UTSW 18 65464116 critical splice donor site probably null
R8112:Malt1 UTSW 18 65449609 critical splice donor site probably null
R8507:Malt1 UTSW 18 65470523 missense probably damaging 1.00
R9009:Malt1 UTSW 18 65444840 missense probably benign 0.15
Z1177:Malt1 UTSW 18 65431373 missense probably damaging 1.00
Z1177:Malt1 UTSW 18 65448284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTAAGTGTTCTTACCTGTTCAG -3'
(R):5'- TTGGCTATATTATTGGCCCAAGC -3'

Sequencing Primer
(F):5'- CAGGATTTGTATGGCTTCACTTAAC -3'
(R):5'- GGCCCAAGCATTGATATTTTATTG -3'
Posted On 2019-06-26