Incidental Mutation 'R7307:Zdhhc6'
ID567357
Institutional Source Beutler Lab
Gene Symbol Zdhhc6
Ensembl Gene ENSMUSG00000024982
Gene Namezinc finger, DHHC domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7307 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55271291-55316032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55313250 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 100 (Y100H)
Ref Sequence ENSEMBL: ENSMUSP00000076157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076891] [ENSMUST00000095950] [ENSMUST00000223690] [ENSMUST00000223807] [ENSMUST00000224291] [ENSMUST00000224897] [ENSMUST00000225495] [ENSMUST00000225529] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably damaging
Transcript: ENSMUST00000076891
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076157
Gene: ENSMUSG00000024982
AA Change: Y100H

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:zf-DHHC 94 244 3.2e-38 PFAM
SH3 316 397 5.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095950
SMART Domains Protein: ENSMUSP00000093644
Gene: ENSMUSG00000024983

DomainStartEndE-ValueType
Pfam:V-SNARE 12 90 7.3e-29 PFAM
t_SNARE 117 184 4.61e-10 SMART
low complexity region 193 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223690
Predicted Effect probably damaging
Transcript: ENSMUST00000223807
AA Change: Y100H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224291
AA Change: Y100H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224897
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225495
AA Change: Y100H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000225529
Predicted Effect probably damaging
Transcript: ENSMUST00000225963
AA Change: Y100H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226103
AA Change: Y100H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6131 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 17,118,395 P155L probably benign Het
Adamts12 G T 15: 11,217,813 L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 Y393N possibly damaging Het
Arhgap45 A G 10: 80,029,182 Q993R probably benign Het
Arhgef33 G C 17: 80,347,120 probably null Het
B4galnt3 T C 6: 120,215,431 D448G probably benign Het
Capn1 C G 19: 5,993,908 E564D possibly damaging Het
Ccdc85a A G 11: 28,399,384 S474P probably benign Het
Cdk12 T A 11: 98,249,800 L1289* probably null Het
Cramp1l A T 17: 24,974,745 N920K possibly damaging Het
Cubn C T 2: 13,340,332 S2091N probably damaging Het
Ddx1 A T 12: 13,223,959 I581N probably damaging Het
Dnm2 A T 9: 21,485,687 N487Y probably damaging Het
Enc1 A C 13: 97,245,093 N37T probably damaging Het
Ephb3 T G 16: 21,222,226 I932S probably benign Het
Frk T A 10: 34,591,938 M316K probably damaging Het
Gdap2 C T 3: 100,202,033 R25C unknown Het
Gm10436 A C 12: 88,181,749 C32W probably damaging Het
Gpat2 T A 2: 127,434,890 D671E probably damaging Het
Gpr179 C T 11: 97,338,846 E828K probably benign Het
Greb1l T C 18: 10,538,142 Y1052H probably damaging Het
Gtf2f1 C T 17: 57,007,833 S69N probably damaging Het
Hid1 A C 11: 115,348,482 I785S probably damaging Het
Hmcn2 T C 2: 31,343,081 I214T probably damaging Het
Hsd3b5 G T 3: 98,619,769 F120L probably damaging Het
Kif16b C T 2: 142,712,931 R649Q probably benign Het
Kif17 A T 4: 138,262,643 E47D probably benign Het
Kmt2b T C 7: 30,580,471 H1368R probably damaging Het
Kmt2d A T 15: 98,849,418 S3342T unknown Het
Krt82 A G 15: 101,542,907 C356R probably damaging Het
Lrit2 A G 14: 37,072,199 K407E probably benign Het
Malt1 T A 18: 65,451,569 H325Q possibly damaging Het
Mccc2 T G 13: 99,988,600 D187A possibly damaging Het
Mgll T A 6: 88,814,121 probably null Het
Mindy2 T G 9: 70,610,959 E449A possibly damaging Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Nlrp4e A G 7: 23,321,528 E480G probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Olfr1288 A T 2: 111,478,760 probably benign Het
Olfr243 G T 7: 103,716,966 R124L probably damaging Het
Olfr350 G A 2: 36,850,125 M26I probably benign Het
Olfr541 G A 7: 140,705,147 V299I probably benign Het
Pcdhb6 A T 18: 37,335,478 H484L probably benign Het
Phldb1 T C 9: 44,694,047 T604A possibly damaging Het
Pitpnm3 G T 11: 72,070,964 A275D probably damaging Het
Polr2a A T 11: 69,747,292 probably null Het
Polr3a A G 14: 24,459,987 C960R probably benign Het
Pou6f2 G A 13: 18,239,713 A159V Het
Pramef6 A C 4: 143,896,775 Y276* probably null Het
Psmc4 A G 7: 28,042,660 V303A probably benign Het
Ptdss2 A G 7: 141,151,732 N151S possibly damaging Het
Ptprk T A 10: 28,589,008 Y1295* probably null Het
Rbm19 A G 5: 120,186,218 K881E possibly damaging Het
Rcan2 T A 17: 44,021,102 Y183* probably null Het
Rnd1 T C 15: 98,670,799 E166G probably damaging Het
Rnf113a2 T A 12: 84,418,179 C282S probably damaging Het
S100b G A 10: 76,257,092 G20R probably benign Het
Sae1 G T 7: 16,368,544 Y168* probably null Het
Samd9l C A 6: 3,372,600 G1554* probably null Het
Samhd1 T C 2: 157,135,020 S55G probably benign Het
Sgsm1 T C 5: 113,273,646 D525G probably benign Het
Slc28a3 A T 13: 58,563,172 M512K probably damaging Het
Slc9b2 T A 3: 135,318,390 N67K probably benign Het
Smarca4 T A 9: 21,638,800 I402N probably damaging Het
St7l T C 3: 104,889,353 F261L probably benign Het
Syde2 T A 3: 146,015,798 V1140D probably damaging Het
Syt6 T A 3: 103,587,472 I251N probably damaging Het
Taok2 T C 7: 126,866,818 E916G probably damaging Het
Tecta A G 9: 42,377,992 S426P probably damaging Het
Thra T C 11: 98,764,308 I338T probably damaging Het
Trub1 A T 19: 57,472,703 Y137F probably damaging Het
Vps13b T C 15: 35,841,545 F2574L probably benign Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Zc3h13 T A 14: 75,330,541 D1091E probably damaging Het
Other mutations in Zdhhc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zdhhc6 APN 19 55309892 missense probably benign 0.19
IGL01419:Zdhhc6 APN 19 55309754 missense probably benign 0.09
IGL02598:Zdhhc6 APN 19 55314527 missense probably benign 0.31
Chalcogenide UTSW 19 55311701 missense probably damaging 1.00
pegmatite UTSW 19 55304439 nonsense probably null
telluride UTSW 19 55314566 start codon destroyed probably null 1.00
R0267:Zdhhc6 UTSW 19 55308930 missense probably benign 0.17
R0920:Zdhhc6 UTSW 19 55311701 missense probably damaging 1.00
R2143:Zdhhc6 UTSW 19 55298796 missense probably benign
R4445:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4446:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4632:Zdhhc6 UTSW 19 55314309 missense probably damaging 1.00
R4921:Zdhhc6 UTSW 19 55313210 missense probably damaging 0.96
R5144:Zdhhc6 UTSW 19 55314566 start codon destroyed probably null 1.00
R7067:Zdhhc6 UTSW 19 55304439 nonsense probably null
R7266:Zdhhc6 UTSW 19 55304500 missense probably damaging 1.00
R7326:Zdhhc6 UTSW 19 55302755 missense possibly damaging 0.88
R8425:Zdhhc6 UTSW 19 55314444 missense probably benign 0.01
R8962:Zdhhc6 UTSW 19 55298807 missense probably benign
R9015:Zdhhc6 UTSW 19 55298886 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATTTCTGACAAGGTGAATGCC -3'
(R):5'- CAGGCGTTGAAAATGCAAGTTACTG -3'

Sequencing Primer
(F):5'- TCAGACCGGACTGTGGGAATTATC -3'
(R):5'- TTGAAAATGCAAGTTACTGGCCCC -3'
Posted On2019-06-26