Incidental Mutation 'R7308:Kcnt1'
ID 567366
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Name potassium channel, subfamily T, member 1
Synonyms C030030G16Rik, Slack, slo2
MMRRC Submission 045323-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R7308 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25753807-25808285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25790475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 479 (F479S)
Ref Sequence ENSEMBL: ENSMUSP00000039058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
AlphaFold Q6ZPR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000037580
AA Change: F479S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: F479S

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114172
AA Change: F465S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: F465S

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114176
AA Change: F479S

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: F479S

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171268
AA Change: F459S

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: F459S

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: F479S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: F479S

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198204
AA Change: F445S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: F445S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200434
AA Change: F445S

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: F445S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,022,993 (GRCm39) I43T probably benign Het
Ankar G A 1: 72,690,953 (GRCm39) Q1175* probably null Het
Aqr G A 2: 113,934,543 (GRCm39) A1366V possibly damaging Het
Arhgap45 G A 10: 79,862,392 (GRCm39) probably null Het
Atf7ip T A 6: 136,542,087 (GRCm39) M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,795,481 (GRCm39) probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,795,464 (GRCm39) probably benign Het
Bcar3 T A 3: 122,302,142 (GRCm39) V279E probably benign Het
Cd96 C T 16: 45,892,097 (GRCm39) probably null Het
Cdca2 G A 14: 67,932,440 (GRCm39) P488S probably benign Het
Cfhr4 A G 1: 139,682,041 (GRCm39) V185A possibly damaging Het
Col4a2 T G 8: 11,456,856 (GRCm39) probably null Het
Cyp4a12a A G 4: 115,184,955 (GRCm39) R379G possibly damaging Het
Defb34 A G 8: 19,176,395 (GRCm39) S29G probably benign Het
Dnah11 A G 12: 117,959,010 (GRCm39) S2958P probably damaging Het
Dync1h1 A G 12: 110,631,596 (GRCm39) D4431G possibly damaging Het
Egfem1 A T 3: 29,206,015 (GRCm39) H84L probably benign Het
Enah A T 1: 181,733,950 (GRCm39) probably null Het
Fam178b G T 1: 36,698,488 (GRCm39) Q78K probably benign Het
Glb1 A G 9: 114,302,931 (GRCm39) N589S probably damaging Het
Gm1527 C T 3: 28,956,429 (GRCm39) H132Y probably benign Het
Gm5799 A G 14: 43,781,164 (GRCm39) R22G possibly damaging Het
Grip2 T C 6: 91,755,669 (GRCm39) D617G possibly damaging Het
Hax1 A T 3: 89,905,873 (GRCm39) D5E possibly damaging Het
Hic1 A G 11: 75,057,977 (GRCm39) L304P probably damaging Het
Hmox1 T A 8: 75,823,647 (GRCm39) I105N probably damaging Het
Hormad1 T C 3: 95,469,866 (GRCm39) S38P probably damaging Het
Hspa4 A G 11: 53,157,930 (GRCm39) S558P possibly damaging Het
Kcnf1 T A 12: 17,224,730 (GRCm39) H497L probably benign Het
Kcnma1 C T 14: 23,381,003 (GRCm39) D1022N probably damaging Het
Krba1 T C 6: 48,383,273 (GRCm39) V203A probably benign Het
Lct G T 1: 128,246,824 (GRCm39) P233Q probably benign Het
Ly75 T C 2: 60,164,859 (GRCm39) D773G probably benign Het
Malt1 T C 18: 65,582,680 (GRCm39) probably null Het
Man1a2 A T 3: 100,527,421 (GRCm39) L333Q probably damaging Het
Mtus1 T C 8: 41,535,965 (GRCm39) T584A probably benign Het
Myof A T 19: 37,899,359 (GRCm39) S1800R probably damaging Het
Nbea A C 3: 55,998,452 (GRCm39) C118W probably damaging Het
Nsd3 A T 8: 26,130,740 (GRCm39) D35V probably damaging Het
Ntaq1 T C 15: 58,016,006 (GRCm39) V85A possibly damaging Het
Or11g24 G A 14: 50,662,722 (GRCm39) V249I possibly damaging Het
Or2y1c G A 11: 49,360,754 (GRCm39) probably benign Het
Pcnx3 C T 19: 5,736,175 (GRCm39) R217H possibly damaging Het
Pcsk4 G A 10: 80,159,007 (GRCm39) P462L probably benign Het
Pdia5 T G 16: 35,276,879 (GRCm39) K96N probably damaging Het
Pik3c2a T C 7: 115,973,074 (GRCm39) Y707C probably damaging Het
Ppig A T 2: 69,579,806 (GRCm39) N447Y unknown Het
Ppp1r9b T C 11: 94,895,397 (GRCm39) L695P possibly damaging Het
Proser1 C T 3: 53,386,125 (GRCm39) A669V probably benign Het
Rdx A T 9: 51,980,170 (GRCm39) K254N probably damaging Het
Slc35f2 T C 9: 53,705,294 (GRCm39) S95P probably benign Het
Slc4a3 T A 1: 75,534,006 (GRCm39) S1118T probably benign Het
Slf1 G A 13: 77,199,287 (GRCm39) P698L probably benign Het
Sptbn2 A G 19: 4,801,602 (GRCm39) E2338G probably benign Het
Taok3 T A 5: 117,338,216 (GRCm39) Y91* probably null Het
Tbc1d31 C T 15: 57,816,212 (GRCm39) L649F probably damaging Het
Tdpoz8 A G 3: 92,981,872 (GRCm39) T223A probably benign Het
Tmem132b A T 5: 125,864,710 (GRCm39) I939F possibly damaging Het
Trav17 T A 14: 54,044,436 (GRCm39) Y69N probably benign Het
Trmt13 T C 3: 116,388,388 (GRCm39) D16G probably benign Het
Upf2 T A 2: 5,978,329 (GRCm39) Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 (GRCm39) T180A probably benign Het
Zfp738 A T 13: 67,817,672 (GRCm39) I773N probably benign Het
Zscan4e A T 7: 11,041,080 (GRCm39) M264K probably benign Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25,782,419 (GRCm39) missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25,806,017 (GRCm39) missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25,788,766 (GRCm39) missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25,790,979 (GRCm39) missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25,778,137 (GRCm39) missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25,802,731 (GRCm39) critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25,798,164 (GRCm39) missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25,790,494 (GRCm39) critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25,791,877 (GRCm39) missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25,790,892 (GRCm39) splice site probably benign
IGL02683:Kcnt1 APN 2 25,790,937 (GRCm39) missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25,799,215 (GRCm39) critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25,784,480 (GRCm39) splice site probably benign
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25,788,276 (GRCm39) splice site probably benign
R0294:Kcnt1 UTSW 2 25,778,122 (GRCm39) missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25,797,640 (GRCm39) missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25,782,508 (GRCm39) missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25,781,255 (GRCm39) splice site probably benign
R1364:Kcnt1 UTSW 2 25,798,106 (GRCm39) missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25,790,397 (GRCm39) missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25,790,481 (GRCm39) missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25,782,372 (GRCm39) missense probably benign
R2079:Kcnt1 UTSW 2 25,790,260 (GRCm39) missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25,781,195 (GRCm39) splice site probably benign
R2295:Kcnt1 UTSW 2 25,790,933 (GRCm39) missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25,784,371 (GRCm39) missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25,790,904 (GRCm39) missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25,805,880 (GRCm39) critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25,783,226 (GRCm39) missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25,806,060 (GRCm39) missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25,767,927 (GRCm39) missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25,768,044 (GRCm39) missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25,797,638 (GRCm39) missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25,798,112 (GRCm39) missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25,799,334 (GRCm39) intron probably benign
R5223:Kcnt1 UTSW 2 25,793,434 (GRCm39) missense probably benign
R5243:Kcnt1 UTSW 2 25,798,086 (GRCm39) missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25,799,289 (GRCm39) missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25,791,921 (GRCm39) nonsense probably null
R5888:Kcnt1 UTSW 2 25,798,122 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,788,413 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,784,536 (GRCm39) intron probably benign
R5927:Kcnt1 UTSW 2 25,799,388 (GRCm39) intron probably benign
R6160:Kcnt1 UTSW 2 25,782,395 (GRCm39) missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25,793,397 (GRCm39) missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25,783,192 (GRCm39) missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25,782,522 (GRCm39) missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25,793,609 (GRCm39) splice site probably null
R6336:Kcnt1 UTSW 2 25,778,767 (GRCm39) splice site probably null
R6395:Kcnt1 UTSW 2 25,799,251 (GRCm39) missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25,801,063 (GRCm39) missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25,767,840 (GRCm39) intron probably benign
R7236:Kcnt1 UTSW 2 25,799,951 (GRCm39) splice site probably null
R7346:Kcnt1 UTSW 2 25,753,855 (GRCm39) unclassified probably benign
R7419:Kcnt1 UTSW 2 25,806,011 (GRCm39) missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25,799,845 (GRCm39) missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25,806,048 (GRCm39) missense probably benign 0.31
R7613:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7778:Kcnt1 UTSW 2 25,791,901 (GRCm39) missense probably benign 0.10
R8031:Kcnt1 UTSW 2 25,798,054 (GRCm39) splice site probably benign
R8088:Kcnt1 UTSW 2 25,784,326 (GRCm39) missense possibly damaging 0.63
R8113:Kcnt1 UTSW 2 25,791,223 (GRCm39) missense possibly damaging 0.67
R8378:Kcnt1 UTSW 2 25,797,283 (GRCm39) missense probably benign 0.03
R8954:Kcnt1 UTSW 2 25,784,338 (GRCm39) missense probably benign
R9231:Kcnt1 UTSW 2 25,801,074 (GRCm39) missense probably benign 0.00
R9445:Kcnt1 UTSW 2 25,767,959 (GRCm39) missense probably damaging 1.00
R9733:Kcnt1 UTSW 2 25,797,351 (GRCm39) missense probably benign 0.00
Z1176:Kcnt1 UTSW 2 25,796,808 (GRCm39) missense probably benign 0.07
Z1177:Kcnt1 UTSW 2 25,799,277 (GRCm39) nonsense probably null
Z1177:Kcnt1 UTSW 2 25,791,240 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCCTGCTTTATCCTCAG -3'
(R):5'- CAGATCATTTGCCAAGGCTG -3'

Sequencing Primer
(F):5'- GCTTTATCCTCAGCAGCAGGAATG -3'
(R):5'- GCTCCTTACTTTCTGATGCAGAGAG -3'
Posted On 2019-06-26