Incidental Mutation 'R7308:Gm1527'
ID567370
Institutional Source Beutler Lab
Gene Symbol Gm1527
Ensembl Gene ENSMUSG00000074655
Gene Namepredicted gene 1527
SynonymsLOC385263
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location28892617-28926724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28902280 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 132 (H132Y)
Ref Sequence ENSEMBL: ENSMUSP00000096773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099170]
Predicted Effect probably benign
Transcript: ENSMUST00000099170
AA Change: H132Y

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000096773
Gene: ENSMUSG00000074655
AA Change: H132Y

DomainStartEndE-ValueType
PH 16 119 2.37e-6 SMART
Pfam:RA 125 214 1.7e-8 PFAM
RhoGAP 300 471 2.8e-29 SMART
transmembrane domain 623 645 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Gm1527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Gm1527 APN 3 28895588 utr 5 prime probably benign
IGL02069:Gm1527 APN 3 28926614 missense possibly damaging 0.53
IGL02794:Gm1527 APN 3 28895680 missense unknown
IGL03285:Gm1527 APN 3 28920417 missense probably damaging 1.00
PIT4403001:Gm1527 UTSW 3 28917985 missense possibly damaging 0.82
R0316:Gm1527 UTSW 3 28915774 missense probably damaging 1.00
R0487:Gm1527 UTSW 3 28926679 missense probably benign 0.00
R1411:Gm1527 UTSW 3 28914483 missense probably benign 0.04
R1458:Gm1527 UTSW 3 28918050 missense possibly damaging 0.52
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1476:Gm1527 UTSW 3 28926556 missense probably benign 0.19
R1523:Gm1527 UTSW 3 28920418 missense probably damaging 1.00
R1613:Gm1527 UTSW 3 28898853 critical splice donor site probably null
R1649:Gm1527 UTSW 3 28898731 missense probably damaging 1.00
R1722:Gm1527 UTSW 3 28921634 missense probably benign 0.10
R1760:Gm1527 UTSW 3 28895550 splice site probably benign
R1857:Gm1527 UTSW 3 28903390 missense probably damaging 0.99
R1981:Gm1527 UTSW 3 28915835 critical splice donor site probably null
R2063:Gm1527 UTSW 3 28926647 missense probably benign 0.04
R2080:Gm1527 UTSW 3 28926661 missense probably benign 0.01
R2115:Gm1527 UTSW 3 28917949 missense probably benign 0.00
R2440:Gm1527 UTSW 3 28895615 missense probably damaging 0.98
R3799:Gm1527 UTSW 3 28926596 missense possibly damaging 0.53
R4012:Gm1527 UTSW 3 28898820 missense probably benign 0.04
R4132:Gm1527 UTSW 3 28920630 missense probably benign 0.37
R4234:Gm1527 UTSW 3 28914366 missense probably damaging 1.00
R4406:Gm1527 UTSW 3 28895725 missense possibly damaging 0.81
R4528:Gm1527 UTSW 3 28914393 missense probably damaging 0.99
R4567:Gm1527 UTSW 3 28914407 missense probably damaging 0.99
R4795:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R4796:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R5127:Gm1527 UTSW 3 28903418 missense probably damaging 1.00
R5774:Gm1527 UTSW 3 28918090 missense probably benign 0.22
R5890:Gm1527 UTSW 3 28915395 missense probably benign 0.03
R6024:Gm1527 UTSW 3 28920603 missense probably benign 0.10
R7092:Gm1527 UTSW 3 28914547 critical splice donor site probably null
R7128:Gm1527 UTSW 3 28915311 missense possibly damaging 0.95
R7197:Gm1527 UTSW 3 28926541 missense probably null 0.00
R7360:Gm1527 UTSW 3 28914542 nonsense probably null
R7380:Gm1527 UTSW 3 28920472 missense probably benign 0.10
R7566:Gm1527 UTSW 3 28920618 missense probably benign 0.02
X0021:Gm1527 UTSW 3 28920468 missense probably damaging 1.00
X0028:Gm1527 UTSW 3 28914500 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGAACTGCTTGTCTGGTATTTAAC -3'
(R):5'- GCATTAGCATGTGGATCAATCTTG -3'

Sequencing Primer
(F):5'- CTGCTTGTCTGGTATTTAACACTAAG -3'
(R):5'- TACACTACAACCAGACTGTC -3'
Posted On2019-06-26