Incidental Mutation 'R7308:Bcar3'
ID567382
Institutional Source Beutler Lab
Gene Symbol Bcar3
Ensembl Gene ENSMUSG00000028121
Gene Namebreast cancer anti-estrogen resistance 3
SynonymsAND-34
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location122294136-122530191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122508493 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 279 (V279E)
Ref Sequence ENSEMBL: ENSMUSP00000029766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029766] [ENSMUST00000197073] [ENSMUST00000198659] [ENSMUST00000199344] [ENSMUST00000199358]
Predicted Effect probably benign
Transcript: ENSMUST00000029766
AA Change: V279E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: V279E

DomainStartEndE-ValueType
low complexity region 126 145 N/A INTRINSIC
SH2 146 234 3.17e-21 SMART
low complexity region 395 406 N/A INTRINSIC
RasGEF 539 814 2.55e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197073
SMART Domains Protein: ENSMUSP00000142469
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 41 60 N/A INTRINSIC
SH2 61 149 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198659
SMART Domains Protein: ENSMUSP00000143112
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3T6A|D 149 186 4e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199344
SMART Domains Protein: ENSMUSP00000143711
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3T6A|D 149 261 3e-61 PDB
SCOP:d1bkds_ 168 260 1e-7 SMART
Blast:RasGEF 190 261 2e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199358
SMART Domains Protein: ENSMUSP00000142340
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
SH2 26 114 2e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Bcar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Bcar3 APN 3 122512936 missense probably benign 0.36
IGL01372:Bcar3 APN 3 122523294 missense probably damaging 1.00
IGL02681:Bcar3 APN 3 122512768 splice site probably null
IGL03403:Bcar3 APN 3 122512969 missense probably benign 0.01
R0408:Bcar3 UTSW 3 122508384 missense probably damaging 0.98
R0531:Bcar3 UTSW 3 122426499 missense probably benign 0.00
R0798:Bcar3 UTSW 3 122525299 missense probably benign 0.01
R1445:Bcar3 UTSW 3 122523191 missense probably damaging 0.98
R1892:Bcar3 UTSW 3 122508136 missense probably benign 0.00
R2138:Bcar3 UTSW 3 122512996 missense probably damaging 1.00
R3236:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3237:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3832:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R4801:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R4802:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R5342:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R5364:Bcar3 UTSW 3 122529632 missense probably benign 0.41
R5560:Bcar3 UTSW 3 122426575 missense possibly damaging 0.92
R5714:Bcar3 UTSW 3 122455087 missense possibly damaging 0.88
R5716:Bcar3 UTSW 3 122512915 missense probably damaging 1.00
R5944:Bcar3 UTSW 3 122523283 missense probably benign
R6478:Bcar3 UTSW 3 122426576 missense probably benign 0.04
R6615:Bcar3 UTSW 3 122426633 missense probably benign 0.00
R6996:Bcar3 UTSW 3 122508384 missense possibly damaging 0.95
R7272:Bcar3 UTSW 3 122508396 missense possibly damaging 0.92
R7353:Bcar3 UTSW 3 122512692 missense probably benign 0.00
R7465:Bcar3 UTSW 3 122523230 missense probably benign 0.13
R7816:Bcar3 UTSW 3 122426694 missense probably benign 0.00
R7899:Bcar3 UTSW 3 122508253 missense probably damaging 0.97
R8066:Bcar3 UTSW 3 122524924 missense probably damaging 1.00
R8165:Bcar3 UTSW 3 122511156 unclassified probably benign
R8285:Bcar3 UTSW 3 122512734 missense probably benign 0.00
Z1177:Bcar3 UTSW 3 122505018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGTGTGCAGTACCAATTC -3'
(R):5'- GGGTTAATCATGCACACTCGTG -3'

Sequencing Primer
(F):5'- CAATTCGAGATGGAGAGCTTTGACTC -3'
(R):5'- TGACCACTATCCACTGACGGTG -3'
Posted On2019-06-26