Incidental Mutation 'R7308:Grip2'
ID567387
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Nameglutamate receptor interacting protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91761509-91827250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91778688 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 617 (D617G)
Ref Sequence ENSEMBL: ENSMUSP00000124709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000161566] [ENSMUST00000162293] [ENSMUST00000162300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159684
AA Change: D576G

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098
AA Change: D576G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161566
SMART Domains Protein: ENSMUSP00000123941
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 9.96e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162293
AA Change: D565G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098
AA Change: D565G

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162300
AA Change: D617G

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098
AA Change: D617G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91782897 missense probably benign 0.00
IGL01748:Grip2 APN 6 91764743 missense probably damaging 1.00
IGL01838:Grip2 APN 6 91764763 missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91787295 missense probably damaging 1.00
IGL02620:Grip2 APN 6 91778606 missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91788104 missense probably damaging 0.98
IGL03027:Grip2 APN 6 91778871 missense probably benign 0.02
IGL03180:Grip2 APN 6 91785761 splice site probably benign
R0265:Grip2 UTSW 6 91773792 critical splice donor site probably null
R0448:Grip2 UTSW 6 91779213 missense probably damaging 1.00
R0597:Grip2 UTSW 6 91796197 intron probably benign
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1664:Grip2 UTSW 6 91765252 missense probably damaging 1.00
R1703:Grip2 UTSW 6 91777398 missense probably damaging 1.00
R1793:Grip2 UTSW 6 91783642 missense probably benign 0.03
R1951:Grip2 UTSW 6 91783848 missense probably damaging 1.00
R2001:Grip2 UTSW 6 91779850 missense probably benign 0.00
R4730:Grip2 UTSW 6 91785712 makesense probably null
R4754:Grip2 UTSW 6 91779182 missense probably damaging 1.00
R4754:Grip2 UTSW 6 91779192 missense probably damaging 0.97
R4773:Grip2 UTSW 6 91782432 missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91773916 missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91779831 missense probably benign 0.04
R5972:Grip2 UTSW 6 91807281 missense probably benign 0.01
R6176:Grip2 UTSW 6 91779851 missense probably benign 0.00
R6188:Grip2 UTSW 6 91763533 missense probably damaging 1.00
R6289:Grip2 UTSW 6 91778871 missense probably benign 0.02
R6345:Grip2 UTSW 6 91765388 missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91780438 missense probably damaging 0.99
R6394:Grip2 UTSW 6 91787201 missense probably damaging 1.00
R6658:Grip2 UTSW 6 91786491 missense probably damaging 1.00
R7065:Grip2 UTSW 6 91783569 critical splice donor site probably null
R7074:Grip2 UTSW 6 91784708 missense probably benign 0.24
R7607:Grip2 UTSW 6 91788412 missense probably benign
R7617:Grip2 UTSW 6 91765050 splice site probably null
R7970:Grip2 UTSW 6 91786532 missense probably benign 0.07
R8221:Grip2 UTSW 6 91785684 missense possibly damaging 0.90
RF003:Grip2 UTSW 6 91783593 missense probably benign 0.02
Z1176:Grip2 UTSW 6 91763510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACATCACACACTCTGGGGAG -3'
(R):5'- TCTCCGACATCAAGAAAGGCAG -3'

Sequencing Primer
(F):5'- ACACTCTGGGGAGCCTTGTAG -3'
(R):5'- CATCAAGAAAGGCAGCGTGGC -3'
Posted On2019-06-26