Incidental Mutation 'R7308:Pik3c2a'
ID567390
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116373839 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 707 (Y707C)
Ref Sequence ENSEMBL: ENSMUSP00000126092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
Predicted Effect probably damaging
Transcript: ENSMUST00000170430
AA Change: Y707C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: Y707C

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206219
AA Change: Y707C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7935:Pik3c2a UTSW 7 116417458 missense probably benign
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAGCTGGATTCTTGTATAGTGC -3'
(R):5'- GGGTATATGCTTCCCACGCTAC -3'

Sequencing Primer
(F):5'- TGACATGACAAAGTCTACAAAGTAAC -3'
(R):5'- CCATTTTGTCACTTGGGAA -3'
Posted On2019-06-26