Incidental Mutation 'R7308:Abca16'
ID567391
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120423770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 43 (I43T)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: I43T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: I43T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: I43T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: I43T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATACCATACTTGTCATGGCTGAC -3'
(R):5'- CAATGTCTACCTTTGATAGTGGTG -3'

Sequencing Primer
(F):5'- ACGTTCGGGCTCTGAACATAC -3'
(R):5'- GGTGTTGAGATTCCTCTTTACATC -3'
Posted On2019-06-26