Incidental Mutation 'R7308:Mtus1'
ID567395
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41082928 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 584 (T584A)
Ref Sequence ENSEMBL: ENSMUSP00000112626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059115] [ENSMUST00000118835] [ENSMUST00000145860] [ENSMUST00000155055]
Predicted Effect probably benign
Transcript: ENSMUST00000059115
AA Change: T584A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: T584A

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118835
AA Change: T584A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: T584A

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143853
Predicted Effect probably benign
Transcript: ENSMUST00000145860
AA Change: T584A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119440
Gene: ENSMUSG00000045636
AA Change: T584A

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155055
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
R8196:Mtus1 UTSW 8 41056652 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACTTCCAAACACTCTGAGC -3'
(R):5'- GATCAGTGTTGCAACCCAAAG -3'

Sequencing Primer
(F):5'- CTTTTCATTTTCACGGGGAGAATGC -3'
(R):5'- GTGTTGCAACCCAAAGACACTTC -3'
Posted On2019-06-26