Incidental Mutation 'R7308:Pcsk4'
ID567401
Institutional Source Beutler Lab
Gene Symbol Pcsk4
Ensembl Gene ENSMUSG00000020131
Gene Nameproprotein convertase subtilisin/kexin type 4
SynonymsPC4, SPC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7308 (G1)
Quality Score137.008
Status Not validated
Chromosome10
Chromosomal Location80321283-80329498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80323173 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 462 (P462L)
Ref Sequence ENSEMBL: ENSMUSP00000020340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000020341] [ENSMUST00000020349] [ENSMUST00000105359] [ENSMUST00000128653] [ENSMUST00000135071]
Predicted Effect probably benign
Transcript: ENSMUST00000020340
AA Change: P462L

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131
AA Change: P462L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020349
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105359
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
PHENOTYPE: Inactivation of this locus results in significantly reduced male fertility, putatively due to impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Pcsk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pcsk4 APN 10 80322823 missense probably damaging 1.00
IGL02818:Pcsk4 APN 10 80322792 missense probably damaging 0.98
IGL03115:Pcsk4 APN 10 80329049 missense probably damaging 1.00
IGL03354:Pcsk4 APN 10 80326059 missense probably damaging 0.99
R0538:Pcsk4 UTSW 10 80325334 missense probably damaging 1.00
R0760:Pcsk4 UTSW 10 80325941 unclassified probably benign
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1554:Pcsk4 UTSW 10 80321951 missense probably benign 0.01
R1728:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1784:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1886:Pcsk4 UTSW 10 80328960 missense probably benign 0.32
R1981:Pcsk4 UTSW 10 80325779 missense probably damaging 1.00
R2090:Pcsk4 UTSW 10 80325821 missense probably benign 0.02
R2125:Pcsk4 UTSW 10 80323879 missense probably benign 0.32
R2283:Pcsk4 UTSW 10 80322750 missense probably damaging 1.00
R4183:Pcsk4 UTSW 10 80325011 missense probably benign 0.12
R4283:Pcsk4 UTSW 10 80329453 unclassified probably benign
R4798:Pcsk4 UTSW 10 80323104 missense probably damaging 1.00
R4857:Pcsk4 UTSW 10 80325039 missense probably damaging 1.00
R4990:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R4991:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R5020:Pcsk4 UTSW 10 80326035 missense probably benign 0.00
R5123:Pcsk4 UTSW 10 80322145 missense probably null 0.56
R5354:Pcsk4 UTSW 10 80323689 missense probably damaging 0.98
R6077:Pcsk4 UTSW 10 80326239 missense probably damaging 0.99
R6102:Pcsk4 UTSW 10 80325817 nonsense probably null
R6250:Pcsk4 UTSW 10 80325592 missense probably benign 0.04
R6378:Pcsk4 UTSW 10 80328975 missense probably benign 0.34
R6729:Pcsk4 UTSW 10 80325101 missense probably damaging 0.99
R7595:Pcsk4 UTSW 10 80322101 missense possibly damaging 0.84
R8004:Pcsk4 UTSW 10 80322840 missense probably damaging 1.00
Z1176:Pcsk4 UTSW 10 80322726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGTCTCACACCTGATGGCC -3'
(R):5'- CACCTTGCGCTTTGTTGTAG -3'

Sequencing Primer
(F):5'- TCACACCTGATGGCCACGAG -3'
(R):5'- GCGCTTTGTTGTAGCTCCC -3'
Posted On2019-06-26