Incidental Mutation 'R7308:Olfr1386'
ID567402
Institutional Source Beutler Lab
Gene Symbol Olfr1386
Ensembl Gene ENSMUSG00000108167
Gene Nameolfactory receptor 1386
SynonymsGA_x6K02T2QP88-5964781-5963852, MOR256-50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7308 (G1)
Quality Score106.008
Status Not validated
Chromosome11
Chromosomal Location49465046-49471715 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 49469927 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071905] [ENSMUST00000204518] [ENSMUST00000213674]
Predicted Effect probably benign
Transcript: ENSMUST00000071905
SMART Domains Protein: ENSMUSP00000071801
Gene: ENSMUSG00000108167

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204518
SMART Domains Protein: ENSMUSP00000145320
Gene: ENSMUSG00000108167

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213674
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Olfr1386
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr1386 APN 11 49471053 missense probably benign 0.00
IGL02698:Olfr1386 APN 11 49470863 missense probably benign 0.02
IGL02727:Olfr1386 APN 11 49471066 missense probably benign 0.04
R0826:Olfr1386 UTSW 11 49470331 missense probably damaging 1.00
R1512:Olfr1386 UTSW 11 49470459 missense probably benign 0.00
R1822:Olfr1386 UTSW 11 49470968 missense probably benign 0.03
R1942:Olfr1386 UTSW 11 49470154 start codon destroyed probably null 0.98
R2282:Olfr1386 UTSW 11 49470643 missense probably damaging 0.96
R4646:Olfr1386 UTSW 11 49470624 missense probably benign 0.00
R4762:Olfr1386 UTSW 11 49470285 missense probably damaging 1.00
R4892:Olfr1386 UTSW 11 49470216 missense probably benign 0.00
R4968:Olfr1386 UTSW 11 49470531 missense probably damaging 1.00
R6882:Olfr1386 UTSW 11 49470463 missense probably benign
R7107:Olfr1386 UTSW 11 49470434 nonsense probably null
R7300:Olfr1386 UTSW 11 49470646 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTGCCTTGTAGAGAGCAG -3'
(R):5'- CACGAATCTAAACAGCATTTCCTG -3'

Sequencing Primer
(F):5'- GCTTGACTTTTGAAGTGCTTAGAATC -3'
(R):5'- GAACCAGGCCCTTTGATTTCCATG -3'
Posted On2019-06-26