Incidental Mutation 'R7308:Dnah11'
ID 567408
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, b2b1289Clo, b2b1203Clo, Dnahc11, avc4, b2b1279Clo, b2b1727Clo, lrd
MMRRC Submission 045323-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.603) question?
Stock # R7308 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 117841717-118162778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117959010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2958 (S2958P)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: S2958P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: S2958P

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,022,993 (GRCm39) I43T probably benign Het
Ankar G A 1: 72,690,953 (GRCm39) Q1175* probably null Het
Aqr G A 2: 113,934,543 (GRCm39) A1366V possibly damaging Het
Arhgap45 G A 10: 79,862,392 (GRCm39) probably null Het
Atf7ip T A 6: 136,542,087 (GRCm39) M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,795,481 (GRCm39) probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,795,464 (GRCm39) probably benign Het
Bcar3 T A 3: 122,302,142 (GRCm39) V279E probably benign Het
Cd96 C T 16: 45,892,097 (GRCm39) probably null Het
Cdca2 G A 14: 67,932,440 (GRCm39) P488S probably benign Het
Cfhr4 A G 1: 139,682,041 (GRCm39) V185A possibly damaging Het
Col4a2 T G 8: 11,456,856 (GRCm39) probably null Het
Cyp4a12a A G 4: 115,184,955 (GRCm39) R379G possibly damaging Het
Defb34 A G 8: 19,176,395 (GRCm39) S29G probably benign Het
Dync1h1 A G 12: 110,631,596 (GRCm39) D4431G possibly damaging Het
Egfem1 A T 3: 29,206,015 (GRCm39) H84L probably benign Het
Enah A T 1: 181,733,950 (GRCm39) probably null Het
Fam178b G T 1: 36,698,488 (GRCm39) Q78K probably benign Het
Glb1 A G 9: 114,302,931 (GRCm39) N589S probably damaging Het
Gm1527 C T 3: 28,956,429 (GRCm39) H132Y probably benign Het
Gm5799 A G 14: 43,781,164 (GRCm39) R22G possibly damaging Het
Grip2 T C 6: 91,755,669 (GRCm39) D617G possibly damaging Het
Hax1 A T 3: 89,905,873 (GRCm39) D5E possibly damaging Het
Hic1 A G 11: 75,057,977 (GRCm39) L304P probably damaging Het
Hmox1 T A 8: 75,823,647 (GRCm39) I105N probably damaging Het
Hormad1 T C 3: 95,469,866 (GRCm39) S38P probably damaging Het
Hspa4 A G 11: 53,157,930 (GRCm39) S558P possibly damaging Het
Kcnf1 T A 12: 17,224,730 (GRCm39) H497L probably benign Het
Kcnma1 C T 14: 23,381,003 (GRCm39) D1022N probably damaging Het
Kcnt1 T C 2: 25,790,475 (GRCm39) F479S possibly damaging Het
Krba1 T C 6: 48,383,273 (GRCm39) V203A probably benign Het
Lct G T 1: 128,246,824 (GRCm39) P233Q probably benign Het
Ly75 T C 2: 60,164,859 (GRCm39) D773G probably benign Het
Malt1 T C 18: 65,582,680 (GRCm39) probably null Het
Man1a2 A T 3: 100,527,421 (GRCm39) L333Q probably damaging Het
Mtus1 T C 8: 41,535,965 (GRCm39) T584A probably benign Het
Myof A T 19: 37,899,359 (GRCm39) S1800R probably damaging Het
Nbea A C 3: 55,998,452 (GRCm39) C118W probably damaging Het
Nsd3 A T 8: 26,130,740 (GRCm39) D35V probably damaging Het
Ntaq1 T C 15: 58,016,006 (GRCm39) V85A possibly damaging Het
Or11g24 G A 14: 50,662,722 (GRCm39) V249I possibly damaging Het
Or2y1c G A 11: 49,360,754 (GRCm39) probably benign Het
Pcnx3 C T 19: 5,736,175 (GRCm39) R217H possibly damaging Het
Pcsk4 G A 10: 80,159,007 (GRCm39) P462L probably benign Het
Pdia5 T G 16: 35,276,879 (GRCm39) K96N probably damaging Het
Pik3c2a T C 7: 115,973,074 (GRCm39) Y707C probably damaging Het
Ppig A T 2: 69,579,806 (GRCm39) N447Y unknown Het
Ppp1r9b T C 11: 94,895,397 (GRCm39) L695P possibly damaging Het
Proser1 C T 3: 53,386,125 (GRCm39) A669V probably benign Het
Rdx A T 9: 51,980,170 (GRCm39) K254N probably damaging Het
Slc35f2 T C 9: 53,705,294 (GRCm39) S95P probably benign Het
Slc4a3 T A 1: 75,534,006 (GRCm39) S1118T probably benign Het
Slf1 G A 13: 77,199,287 (GRCm39) P698L probably benign Het
Sptbn2 A G 19: 4,801,602 (GRCm39) E2338G probably benign Het
Taok3 T A 5: 117,338,216 (GRCm39) Y91* probably null Het
Tbc1d31 C T 15: 57,816,212 (GRCm39) L649F probably damaging Het
Tdpoz8 A G 3: 92,981,872 (GRCm39) T223A probably benign Het
Tmem132b A T 5: 125,864,710 (GRCm39) I939F possibly damaging Het
Trav17 T A 14: 54,044,436 (GRCm39) Y69N probably benign Het
Trmt13 T C 3: 116,388,388 (GRCm39) D16G probably benign Het
Upf2 T A 2: 5,978,329 (GRCm39) Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 (GRCm39) T180A probably benign Het
Zfp738 A T 13: 67,817,672 (GRCm39) I773N probably benign Het
Zscan4e A T 7: 11,041,080 (GRCm39) M264K probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118,162,480 (GRCm39) missense probably benign 0.28
IGL00422:Dnah11 APN 12 118,031,831 (GRCm39) missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118,000,194 (GRCm39) missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118,150,657 (GRCm39) missense probably benign 0.01
IGL00687:Dnah11 APN 12 117,885,739 (GRCm39) splice site probably benign
IGL00833:Dnah11 APN 12 118,143,315 (GRCm39) missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117,874,937 (GRCm39) missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118,160,386 (GRCm39) missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118,106,669 (GRCm39) splice site probably benign
IGL01121:Dnah11 APN 12 118,014,430 (GRCm39) missense probably benign 0.02
IGL01143:Dnah11 APN 12 117,976,475 (GRCm39) missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117,946,734 (GRCm39) missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118,156,134 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118,010,991 (GRCm39) nonsense probably null
IGL01418:Dnah11 APN 12 117,951,217 (GRCm39) nonsense probably null
IGL01444:Dnah11 APN 12 117,983,967 (GRCm39) missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117,946,767 (GRCm39) missense probably benign 0.15
IGL01645:Dnah11 APN 12 118,150,733 (GRCm39) missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118,156,005 (GRCm39) splice site probably benign
IGL02104:Dnah11 APN 12 118,156,125 (GRCm39) missense probably benign
IGL02151:Dnah11 APN 12 118,023,623 (GRCm39) splice site probably benign
IGL02189:Dnah11 APN 12 118,046,314 (GRCm39) missense probably benign 0.00
IGL02417:Dnah11 APN 12 118,020,915 (GRCm39) missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118,150,637 (GRCm39) missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117,939,608 (GRCm39) splice site probably benign
IGL02474:Dnah11 APN 12 117,991,180 (GRCm39) splice site probably null
IGL02526:Dnah11 APN 12 118,143,353 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117,874,775 (GRCm39) missense probably damaging 1.00
IGL03011:Dnah11 APN 12 117,976,112 (GRCm39) missense probably benign 0.08
IGL03061:Dnah11 APN 12 117,866,856 (GRCm39) missense probably damaging 1.00
IGL03182:Dnah11 APN 12 117,994,026 (GRCm39) missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118,069,720 (GRCm39) missense probably benign
IGL03238:Dnah11 APN 12 118,073,633 (GRCm39) missense probably damaging 1.00
IGL03493:Dnah11 APN 12 117,976,533 (GRCm39) missense probably benign 0.00
P0045:Dnah11 UTSW 12 117,994,062 (GRCm39) missense probably benign
R0009:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118,090,621 (GRCm39) missense probably benign 0.05
R0172:Dnah11 UTSW 12 117,951,188 (GRCm39) missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117,946,791 (GRCm39) nonsense probably null
R0270:Dnah11 UTSW 12 118,004,748 (GRCm39) missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118,090,868 (GRCm39) missense probably benign 0.03
R0325:Dnah11 UTSW 12 117,976,074 (GRCm39) missense probably benign
R0370:Dnah11 UTSW 12 117,958,962 (GRCm39) missense probably benign
R0416:Dnah11 UTSW 12 117,874,793 (GRCm39) missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118,070,245 (GRCm39) missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably benign 0.01
R0607:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117,951,204 (GRCm39) missense probably damaging 1.00
R0635:Dnah11 UTSW 12 117,971,731 (GRCm39) missense probably damaging 1.00
R0755:Dnah11 UTSW 12 118,162,360 (GRCm39) missense probably benign 0.17
R0755:Dnah11 UTSW 12 117,918,564 (GRCm39) missense possibly damaging 0.95
R0789:Dnah11 UTSW 12 117,874,967 (GRCm39) missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0835:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0846:Dnah11 UTSW 12 117,897,585 (GRCm39) missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118,154,579 (GRCm39) nonsense probably null
R0928:Dnah11 UTSW 12 118,009,297 (GRCm39) missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118,024,142 (GRCm39) missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117,897,547 (GRCm39) missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117,936,099 (GRCm39) missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118,020,841 (GRCm39) nonsense probably null
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1500:Dnah11 UTSW 12 117,976,564 (GRCm39) splice site probably null
R1535:Dnah11 UTSW 12 117,982,465 (GRCm39) missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117,894,991 (GRCm39) missense probably benign 0.01
R1554:Dnah11 UTSW 12 118,046,234 (GRCm39) missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R1618:Dnah11 UTSW 12 117,979,200 (GRCm39) missense probably damaging 0.98
R1638:Dnah11 UTSW 12 117,979,154 (GRCm39) missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118,084,459 (GRCm39) missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117,897,580 (GRCm39) missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118,154,603 (GRCm39) missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118,160,379 (GRCm39) missense probably benign 0.32
R1728:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118,154,560 (GRCm39) missense probably benign 0.31
R1780:Dnah11 UTSW 12 117,991,293 (GRCm39) missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118,002,515 (GRCm39) missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118,027,587 (GRCm39) missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118,091,291 (GRCm39) missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118,046,203 (GRCm39) missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118,077,606 (GRCm39) missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 117,976,451 (GRCm39) missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 117,984,088 (GRCm39) missense probably damaging 1.00
R2140:Dnah11 UTSW 12 117,972,545 (GRCm39) missense probably benign 0.01
R2261:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2261:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2262:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117,850,421 (GRCm39) missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117,892,065 (GRCm39) missense probably damaging 1.00
R2410:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117,951,162 (GRCm39) nonsense probably null
R3499:Dnah11 UTSW 12 117,874,758 (GRCm39) missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3742:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3779:Dnah11 UTSW 12 118,094,448 (GRCm39) splice site probably benign
R3785:Dnah11 UTSW 12 117,981,337 (GRCm39) missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117,942,188 (GRCm39) splice site probably benign
R4014:Dnah11 UTSW 12 117,938,649 (GRCm39) missense probably benign 0.16
R4043:Dnah11 UTSW 12 117,843,678 (GRCm39) missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118,070,227 (GRCm39) missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4074:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4076:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4201:Dnah11 UTSW 12 117,930,394 (GRCm39) missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118,094,627 (GRCm39) missense probably benign 0.06
R4233:Dnah11 UTSW 12 117,880,526 (GRCm39) missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118,089,578 (GRCm39) nonsense probably null
R4430:Dnah11 UTSW 12 117,946,746 (GRCm39) missense probably benign 0.26
R4465:Dnah11 UTSW 12 117,951,186 (GRCm39) missense probably benign 0.09
R4489:Dnah11 UTSW 12 117,880,631 (GRCm39) missense probably benign 0.31
R4572:Dnah11 UTSW 12 117,973,860 (GRCm39) missense probably benign 0.00
R4574:Dnah11 UTSW 12 117,975,990 (GRCm39) critical splice donor site probably null
R4657:Dnah11 UTSW 12 118,156,162 (GRCm39) missense probably benign 0.02
R4709:Dnah11 UTSW 12 117,982,495 (GRCm39) missense probably benign 0.26
R4740:Dnah11 UTSW 12 118,084,279 (GRCm39) missense probably benign 0.28
R4803:Dnah11 UTSW 12 118,091,343 (GRCm39) missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117,958,935 (GRCm39) missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118,090,618 (GRCm39) missense probably benign 0.37
R5018:Dnah11 UTSW 12 118,094,463 (GRCm39) missense probably benign 0.00
R5071:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5074:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5080:Dnah11 UTSW 12 118,162,565 (GRCm39) start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 117,981,435 (GRCm39) missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117,918,486 (GRCm39) missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118,121,096 (GRCm39) missense probably benign 0.09
R5252:Dnah11 UTSW 12 118,089,676 (GRCm39) missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117,847,151 (GRCm39) missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118,049,415 (GRCm39) missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117,918,628 (GRCm39) missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118,049,432 (GRCm39) missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117,844,186 (GRCm39) critical splice donor site probably null
R5546:Dnah11 UTSW 12 117,939,583 (GRCm39) missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 117,982,537 (GRCm39) missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117,847,352 (GRCm39) missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118,077,642 (GRCm39) missense probably benign 0.04
R5706:Dnah11 UTSW 12 117,987,670 (GRCm39) missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118,090,841 (GRCm39) missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118,156,125 (GRCm39) missense probably benign
R5884:Dnah11 UTSW 12 118,141,269 (GRCm39) missense probably benign 0.00
R5900:Dnah11 UTSW 12 118,046,166 (GRCm39) splice site probably null
R5905:Dnah11 UTSW 12 117,918,659 (GRCm39) missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117,878,371 (GRCm39) splice site probably null
R5973:Dnah11 UTSW 12 118,074,687 (GRCm39) missense probably benign 0.02
R6024:Dnah11 UTSW 12 117,994,007 (GRCm39) missense probably benign 0.34
R6056:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign 0.03
R6075:Dnah11 UTSW 12 118,068,586 (GRCm39) missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign
R6191:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R6197:Dnah11 UTSW 12 118,143,482 (GRCm39) missense probably benign 0.03
R6262:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117,880,590 (GRCm39) missense probably benign 0.01
R6614:Dnah11 UTSW 12 117,850,411 (GRCm39) missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118,150,617 (GRCm39) splice site probably null
R6712:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118,009,381 (GRCm39) missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118,077,629 (GRCm39) missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117,951,411 (GRCm39) splice site probably null
R6895:Dnah11 UTSW 12 117,958,926 (GRCm39) missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118,070,297 (GRCm39) missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118,162,503 (GRCm39) missense probably benign
R6945:Dnah11 UTSW 12 118,024,045 (GRCm39) missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117,897,544 (GRCm39) missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118,072,679 (GRCm39) missense probably benign 0.00
R6976:Dnah11 UTSW 12 118,162,378 (GRCm39) missense probably benign 0.16
R7000:Dnah11 UTSW 12 117,981,396 (GRCm39) missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117,885,753 (GRCm39) frame shift probably null
R7101:Dnah11 UTSW 12 118,031,880 (GRCm39) missense probably benign
R7106:Dnah11 UTSW 12 117,924,884 (GRCm39) missense probably benign 0.15
R7203:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118,090,624 (GRCm39) missense probably benign 0.00
R7219:Dnah11 UTSW 12 118,004,830 (GRCm39) missense possibly damaging 0.95
R7361:Dnah11 UTSW 12 117,982,477 (GRCm39) missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117,951,177 (GRCm39) missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118,089,520 (GRCm39) missense probably damaging 1.00
R7399:Dnah11 UTSW 12 117,991,212 (GRCm39) missense probably benign 0.00
R7404:Dnah11 UTSW 12 118,068,543 (GRCm39) missense probably benign 0.36
R7473:Dnah11 UTSW 12 117,866,911 (GRCm39) missense probably benign 0.19
R7545:Dnah11 UTSW 12 117,894,939 (GRCm39) missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118,104,505 (GRCm39) splice site probably null
R7625:Dnah11 UTSW 12 118,160,377 (GRCm39) missense probably benign
R7761:Dnah11 UTSW 12 117,987,648 (GRCm39) missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118,004,744 (GRCm39) missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117,951,237 (GRCm39) missense probably benign 0.04
R7904:Dnah11 UTSW 12 117,867,003 (GRCm39) missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117,930,368 (GRCm39) missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117,842,284 (GRCm39) missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 117,976,181 (GRCm39) missense probably benign
R8254:Dnah11 UTSW 12 117,842,259 (GRCm39) missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 117,991,243 (GRCm39) nonsense probably null
R8272:Dnah11 UTSW 12 118,074,752 (GRCm39) missense probably benign 0.01
R8344:Dnah11 UTSW 12 118,049,466 (GRCm39) missense probably benign 0.00
R8515:Dnah11 UTSW 12 117,939,533 (GRCm39) missense probably damaging 1.00
R8528:Dnah11 UTSW 12 117,972,538 (GRCm39) missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117,842,247 (GRCm39) missense probably benign
R8676:Dnah11 UTSW 12 118,154,539 (GRCm39) missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118,049,384 (GRCm39) critical splice donor site probably null
R8773:Dnah11 UTSW 12 117,958,950 (GRCm39) missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117,874,764 (GRCm39) missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8866:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8881:Dnah11 UTSW 12 118,090,550 (GRCm39) missense probably benign 0.05
R8881:Dnah11 UTSW 12 118,077,647 (GRCm39) missense probably benign 0.00
R8920:Dnah11 UTSW 12 118,077,674 (GRCm39) missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118,091,381 (GRCm39) missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 117,987,718 (GRCm39) missense probably benign 0.36
R8962:Dnah11 UTSW 12 117,918,630 (GRCm39) missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117,916,273 (GRCm39) missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118,094,578 (GRCm39) missense probably benign 0.00
R9155:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9162:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9164:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117,894,918 (GRCm39) missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R9205:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9208:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117,951,095 (GRCm39) missense probably damaging 1.00
R9264:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R9290:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9291:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118,143,341 (GRCm39) missense probably benign 0.11
R9353:Dnah11 UTSW 12 118,143,434 (GRCm39) missense probably benign 0.00
R9375:Dnah11 UTSW 12 117,884,703 (GRCm39) missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118,141,290 (GRCm39) missense probably benign 0.00
R9392:Dnah11 UTSW 12 118,011,055 (GRCm39) nonsense probably null
R9433:Dnah11 UTSW 12 117,976,007 (GRCm39) missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117,878,352 (GRCm39) missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118,150,711 (GRCm39) missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117,938,728 (GRCm39) missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 117,982,513 (GRCm39) missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118,094,770 (GRCm39) missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118,024,148 (GRCm39) missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117,842,311 (GRCm39) nonsense probably null
R9764:Dnah11 UTSW 12 117,884,704 (GRCm39) missense probably benign 0.05
RF023:Dnah11 UTSW 12 117,918,585 (GRCm39) missense probably damaging 1.00
RF047:Dnah11 UTSW 12 117,973,818 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,858,747 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,946,704 (GRCm39) missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 118,094,534 (GRCm39) missense probably damaging 0.97
Z1176:Dnah11 UTSW 12 118,090,854 (GRCm39) missense probably benign 0.00
Z1176:Dnah11 UTSW 12 117,894,912 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTGAAAGTGGCTGACCGAG -3'
(R):5'- AAAGTCAATGCTACCTTGCACC -3'

Sequencing Primer
(F):5'- CCTGCCAATAGTGTACTGAGACTTG -3'
(R):5'- AATGCTACCTTGCACCTTGCTG -3'
Posted On 2019-06-26