Incidental Mutation 'R7308:Slf1'
ID567410
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77051168 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 698 (P698L)
Ref Sequence ENSEMBL: ENSMUSP00000118312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524]
Predicted Effect probably benign
Transcript: ENSMUST00000151524
AA Change: P698L

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: P698L

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 splice site probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
R7807:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R8175:Slf1 UTSW 13 77112671 missense probably damaging 1.00
R8385:Slf1 UTSW 13 77105990 missense probably benign
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTGAAGCCAGAAGATC -3'
(R):5'- GCACAATCCATAGTGAAGATATGG -3'

Sequencing Primer
(F):5'- GTGATTTGAACCATGGAGCCATCTC -3'
(R):5'- TCCATAGTGAAGATATGGGGGAAATG -3'
Posted On2019-06-26