Incidental Mutation 'R7308:Trav17'
ID567414
Institutional Source Beutler Lab
Gene Symbol Trav17
Ensembl Gene ENSMUSG00000096397
Gene NameT cell receptor alpha variable 17
SynonymsOTTMUSG00000015028
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location53806525-53807113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53806979 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 69 (Y69N)
Ref Sequence ENSEMBL: ENSMUSP00000100449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103672] [ENSMUST00000186545]
Predicted Effect probably benign
Transcript: ENSMUST00000103672
AA Change: Y69N

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100449
Gene: ENSMUSG00000096397
AA Change: Y69N

DomainStartEndE-ValueType
Pfam:V-set 20 113 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186545
AA Change: Y68N

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140087
Gene: ENSMUSG00000096397
AA Change: Y68N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG_like 36 111 4.9e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Trav17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03124:Trav17 APN 14 53806649 missense probably benign 0.01
R2867:Trav17 UTSW 14 53806926 missense probably benign 0.03
R2867:Trav17 UTSW 14 53806926 missense probably benign 0.03
R2903:Trav17 UTSW 14 53806666 missense probably benign 0.17
R4776:Trav17 UTSW 14 53806640 start codon destroyed probably null 1.00
R7451:Trav17 UTSW 14 53806639 start codon destroyed probably damaging 0.98
R7588:Trav17 UTSW 14 53806845 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTACTGCTACGTTGGTATTACAGG -3'
(R):5'- GAATCGTTCTTGGTGTGCCC -3'

Sequencing Primer
(F):5'- GAGGAAACAGTGCCCAGTCC -3'
(R):5'- TCGTGCACAGAAGGTCTCAG -3'
Posted On2019-06-26