Incidental Mutation 'R7308:Cdca2'
ID567415
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Namecell division cycle associated 2
Synonyms2610311M19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110162, NM_175384

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location67676331-67715841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67694991 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 488 (P488S)
Ref Sequence ENSEMBL: ENSMUSP00000117847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132705] [ENSMUST00000150006] [ENSMUST00000163100]
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000123664
Gene: ENSMUSG00000048922
AA Change: P43S

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132705
AA Change: P488S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: P488S

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150006
AA Change: P488S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: P488S

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163100
AA Change: P488S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: P488S

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Nsd3 A T 8: 25,640,724 D35V probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0368:Cdca2 UTSW 14 67700347 missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4043:Cdca2 UTSW 14 67704006 missense probably benign 0.11
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67713140 missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6866:Cdca2 UTSW 14 67693666 missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
R7080:Cdca2 UTSW 14 67698102 missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67707351 critical splice donor site probably null
R7292:Cdca2 UTSW 14 67677877 nonsense probably null
R7310:Cdca2 UTSW 14 67713224 missense probably damaging 1.00
R7877:Cdca2 UTSW 14 67677216 missense probably benign
R8012:Cdca2 UTSW 14 67677372 missense probably benign 0.23
R8080:Cdca2 UTSW 14 67677555 nonsense probably null
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67680244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCATGACCATGAAGATTG -3'
(R):5'- ACGACATTTAAGAGCAACTGTG -3'

Sequencing Primer
(F):5'- ACAGGGTTTCTCTGTGTAGCCC -3'
(R):5'- CTGTGACTCAAAAACACTATGCTG -3'
Posted On2019-06-26