Mutagenetix > Incidental Mutation

Incidental Mutation 'R0637:Alms1'

56744

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

038826-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0637 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85623033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2083 (T2083A)

Ref Sequence

ENSEMBL: ENSMUSP00000148796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072018
AA Change: T1614A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: T1614A

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213058
AA Change: T2083A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.0756

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 94.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat1	C	T	9: 53,587,531	D285N	probably damaging	Het
Aldh3a1	G	A	11: 61,215,478		probably benign	Het
Atrip	C	T	9: 109,061,173	M143I	possibly damaging	Het
Aup1	T	A	6: 83,056,861	V344D	probably damaging	Het
Baiap2	G	A	11: 120,000,579	V511M	probably benign	Het
Bnip2	T	A	9: 70,003,673		probably null	Het
Cacna1i	A	T	15: 80,372,654	Y1083F	probably damaging	Het
Cbr4	T	C	8: 61,490,706		probably benign	Het
Ces2b	C	T	8: 104,834,605		probably benign	Het
Chd1	A	G	17: 15,742,288	N769S	possibly damaging	Het
Clca3b	A	T	3: 144,827,940	V558D	probably benign	Het
Col12a1	T	C	9: 79,656,735	D1736G	probably benign	Het
Cpne8	C	A	15: 90,648,621	C61F	probably damaging	Het
Cxcr1	A	G	1: 74,192,839	I8T	probably benign	Het
D630003M21Rik	T	G	2: 158,195,407		probably benign	Het
Dcaf17	T	A	2: 71,060,419	D99E	probably damaging	Het
Fam60a	A	G	6: 148,930,665		probably benign	Het
Fbf1	C	T	11: 116,160,054		probably benign	Het
Fgfr2	T	A	7: 130,171,624	H570L	possibly damaging	Het
Gars	G	A	6: 55,069,487		probably null	Het
Gm10309	A	G	17: 86,499,035		probably benign	Het
Gm13023	A	T	4: 143,793,909	Y77F	probably benign	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Gm9892	G	A	8: 52,196,825	Q78*	probably null	Het
Has1	A	G	17: 17,843,863	Y505H	possibly damaging	Het
Hivep3	T	A	4: 120,132,541	L2063*	probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Itgb3	T	C	11: 104,658,876	V614A	probably benign	Het
Lrrc23	A	G	6: 124,778,358		probably benign	Het
Lrrc63	A	T	14: 75,098,220		probably benign	Het
Mfhas1	C	T	8: 35,590,026	R357*	probably null	Het
Mink1	C	A	11: 70,601,676	N123K	probably damaging	Het
Mtmr4	A	G	11: 87,611,064	H591R	probably benign	Het
Nav3	T	C	10: 109,770,197	T923A	probably benign	Het
Ncapg	A	G	5: 45,687,324	T554A	probably damaging	Het
Nfe2l1	T	C	11: 96,827,688	Y7C	probably damaging	Het
Nol8	C	T	13: 49,662,447	A677V	possibly damaging	Het
Obscn	A	T	11: 59,051,644	M4904K	probably damaging	Het
Obscn	G	T	11: 59,082,776	L1910I	probably damaging	Het
Olfr890	T	C	9: 38,143,882	F244S	probably benign	Het
Pcdhb15	T	A	18: 37,475,566	V617E	probably damaging	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Pgrmc1	T	C	X: 36,602,271	F160S	probably damaging	Het
Pink1	G	T	4: 138,318,046	P239Q	probably damaging	Het
Prr27	A	G	5: 87,851,146		probably benign	Het
Rbpms	G	A	8: 33,806,836	P138S	probably damaging	Het
Rcc2	T	C	4: 140,717,744		probably benign	Het
Rgs3	T	C	4: 62,646,673		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	C	T	16: 73,001,951	T933M	probably benign	Het
Steap4	T	C	5: 7,978,398		probably benign	Het
Tenm3	T	C	8: 48,236,525	Y2009C	probably damaging	Het
Tnr	A	C	1: 159,850,335	T97P	possibly damaging	Het
Topaz1	T	A	9: 122,791,477	L1320*	probably null	Het
Topaz1	A	G	9: 122,797,662	M1452V	probably benign	Het
Trank1	T	G	9: 111,390,441	F2082C	probably damaging	Het
Trim24	C	A	6: 37,958,559		probably null	Het
Tspoap1	T	A	11: 87,777,240		probably benign	Het
Ubr4	T	C	4: 139,399,615	L483P	probably damaging	Het
Vmn2r2	T	A	3: 64,126,578	T508S	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp366	C	A	13: 99,228,966	R212S	probably damaging	Het
Zkscan4	T	A	13: 21,481,307	C122S	probably damaging	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ATGAGGTCTGAACCTGAAGGCTGC -3'
(R):5'- ACTGCTAAGCTGTAAACAAGCGTGG -3'

Sequencing Primer
(F):5'- TGCAGTACAGGCATTGGG -3'
(R):5'- TGCCTATTATGTCAGTGAGTCC -3'

Posted On

2013-07-11