Incidental Mutation 'R7309:Kcna7'
ID567442
Institutional Source Beutler Lab
Gene Symbol Kcna7
Ensembl Gene ENSMUSG00000038201
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 7
SynonymsKv1.7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7309 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45405653-45409763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45409255 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 322 (F322C)
Ref Sequence ENSEMBL: ENSMUSP00000103403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058879] [ENSMUST00000107774] [ENSMUST00000210347]
Predicted Effect probably benign
Transcript: ENSMUST00000058879
SMART Domains Protein: ENSMUSP00000057916
Gene: ENSMUSG00000074121

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 50 74 N/A INTRINSIC
NGF 88 201 8.06e-83 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107774
AA Change: F322C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103403
Gene: ENSMUSG00000038201
AA Change: F322C

DomainStartEndE-ValueType
BTB 45 145 1.77e-7 SMART
Pfam:Ion_trans 174 438 1.7e-52 PFAM
Pfam:Ion_trans_2 346 432 1.7e-13 PFAM
low complexity region 471 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210347
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mpdz A T 4: 81,381,958 probably null Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Kcna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Kcna7 APN 7 45406511 missense probably damaging 1.00
IGL02477:Kcna7 APN 7 45409623 missense probably benign 0.01
R0373:Kcna7 UTSW 7 45409444 missense probably damaging 1.00
R0624:Kcna7 UTSW 7 45409690 missense probably null 1.00
R0850:Kcna7 UTSW 7 45409431 missense probably damaging 0.99
R1721:Kcna7 UTSW 7 45406921 missense possibly damaging 0.95
R1727:Kcna7 UTSW 7 45409506 missense possibly damaging 0.94
R3040:Kcna7 UTSW 7 45406788 frame shift probably null
R3755:Kcna7 UTSW 7 45408945 missense probably benign 0.00
R5024:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5054:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5055:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5056:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5549:Kcna7 UTSW 7 45406639 missense probably damaging 0.98
R6669:Kcna7 UTSW 7 45409564 missense probably damaging 1.00
R7284:Kcna7 UTSW 7 45409228 missense probably damaging 1.00
Z1088:Kcna7 UTSW 7 45406959 missense probably benign 0.21
Z1088:Kcna7 UTSW 7 45409105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCTGTGTATCTGCTGG -3'
(R):5'- AAAAGGACTCCGGGATGCTG -3'

Sequencing Primer
(F):5'- CTCCTTTGAGCTGCTGGTGC -3'
(R):5'- ACTCCGGGATGCTGGTGAAATG -3'
Posted On2019-06-26