Incidental Mutation 'R7309:Mthfsd'
ID567450
Institutional Source Beutler Lab
Gene Symbol Mthfsd
Ensembl Gene ENSMUSG00000031816
Gene Namemethenyltetrahydrofolate synthetase domain containing
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7309 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location121091628-121108392 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 121108331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047282] [ENSMUST00000116415] [ENSMUST00000126431] [ENSMUST00000127664] [ENSMUST00000128052] [ENSMUST00000133037] [ENSMUST00000134758] [ENSMUST00000139782] [ENSMUST00000151576]
Predicted Effect probably benign
Transcript: ENSMUST00000047282
SMART Domains Protein: ENSMUSP00000044172
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 1.1e-31 PFAM
RRM 278 346 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116415
SMART Domains Protein: ENSMUSP00000112116
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 2.3e-36 PFAM
RRM 297 365 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126431
SMART Domains Protein: ENSMUSP00000119673
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:5-FTHF_cyc-lig 81 278 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128052
Predicted Effect probably benign
Transcript: ENSMUST00000133037
SMART Domains Protein: ENSMUSP00000117429
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 7.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134758
Predicted Effect probably benign
Transcript: ENSMUST00000139782
SMART Domains Protein: ENSMUSP00000115382
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mpdz A T 4: 81,381,958 probably null Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Mthfsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Mthfsd APN 8 121104468 missense probably damaging 1.00
IGL03002:Mthfsd APN 8 121108279 splice site probably benign
R0076:Mthfsd UTSW 8 121098739 missense probably benign 0.04
R0416:Mthfsd UTSW 8 121101237 missense probably damaging 1.00
R0745:Mthfsd UTSW 8 121102949 missense probably damaging 1.00
R2157:Mthfsd UTSW 8 121101501 missense probably damaging 1.00
R2851:Mthfsd UTSW 8 121105773 missense probably benign 0.38
R3439:Mthfsd UTSW 8 121099121 missense possibly damaging 0.89
R4207:Mthfsd UTSW 8 121105626 missense probably damaging 1.00
R4456:Mthfsd UTSW 8 121105765 missense possibly damaging 0.89
R4757:Mthfsd UTSW 8 121098998 critical splice donor site probably null
R5154:Mthfsd UTSW 8 121098740 missense probably damaging 1.00
R5208:Mthfsd UTSW 8 121108319 unclassified probably benign
R5496:Mthfsd UTSW 8 121098814 nonsense probably null
R6652:Mthfsd UTSW 8 121098821 missense probably damaging 1.00
R7538:Mthfsd UTSW 8 121098786 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGGCTGGCTAAAACCTGTC -3'
(R):5'- GACCTCTGGTCCTCTAATGC -3'

Sequencing Primer
(F):5'- AGGATGGGACTGATCCTCC -3'
(R):5'- AATGCGTCGGTGCTACTAC -3'
Posted On2019-06-26