Incidental Mutation 'R7309:Slfn5'
ID567454
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7309 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82956703 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000064819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably damaging
Transcript: ENSMUST00000067443
AA Change: L138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: L138P

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108157
AA Change: L138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: L138P

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108158
AA Change: L138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404
AA Change: L138P

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Meta Mutation Damage Score 0.6949 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Lrrc14b C A 13: 74,363,202 C253F probably benign Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mpdz A T 4: 81,381,958 probably null Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGGCTTGAATCTGCCAC -3'
(R):5'- CTCTCTAATGCCCTGGGAAAG -3'

Sequencing Primer
(F):5'- GGCTTGAATCTGCCACCATTG -3'
(R):5'- CTCTAATGCCCTGGGAAAGGTCTG -3'
Posted On2019-06-26