Incidental Mutation 'R7309:Lrrc14b'
ID567458
Institutional Source Beutler Lab
Gene Symbol Lrrc14b
Ensembl Gene ENSMUSG00000021579
Gene Nameleucine rich repeat containing 14B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7309 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74359578-74364005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74363202 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 253 (C253F)
Ref Sequence ENSEMBL: ENSMUSP00000022064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162672]
Predicted Effect probably benign
Transcript: ENSMUST00000022063
SMART Domains Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
coiled coil region 78 140 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022064
AA Change: C253F

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579
AA Change: C253F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 208 417 8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159931
SMART Domains Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160021
SMART Domains Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,736,953 H346Q probably damaging Het
4932414N04Rik A T 2: 68,716,186 I71L probably benign Het
Anapc1 A G 2: 128,674,684 S377P probably damaging Het
Cldnd2 A G 7: 43,441,709 T22A possibly damaging Het
Comp A T 8: 70,373,678 probably null Het
Cop1 A G 1: 159,306,625 K446E probably damaging Het
Cox18 T C 5: 90,215,058 T314A possibly damaging Het
Csrp3 A G 7: 48,835,569 V60A probably benign Het
Dnah8 A T 17: 30,875,014 Y4694F probably damaging Het
Dnm1l A G 16: 16,321,646 Y493H probably damaging Het
Esf1 A T 2: 140,125,091 probably null Het
Fam187a T A 11: 102,886,006 V212E probably damaging Het
Fign A T 2: 63,979,957 M323K possibly damaging Het
Foxf2 A G 13: 31,626,513 K145R probably damaging Het
Fxyd5 T C 7: 31,035,404 N133D probably benign Het
Hnrnpdl A T 5: 100,037,623 L240* probably null Het
Kcna7 T G 7: 45,409,255 F322C probably damaging Het
Kcnj9 A G 1: 172,326,258 C100R probably damaging Het
Map3k11 T C 19: 5,690,458 V71A probably damaging Het
Med13 C A 11: 86,291,062 M1315I probably benign Het
Mettl24 T C 10: 40,810,500 V291A probably benign Het
Miox G T 15: 89,336,049 C148F probably damaging Het
Mpdz A T 4: 81,381,958 probably null Het
Mthfsd G A 8: 121,108,331 probably benign Het
Myh15 G A 16: 49,096,465 A383T probably benign Het
Nlrc5 A G 8: 94,474,042 H117R probably benign Het
Ntrk1 A T 3: 87,795,077 M23K probably benign Het
Olfr140 T A 2: 90,051,457 N289I probably damaging Het
Olfr297 T A 7: 86,527,141 L128H probably damaging Het
Olfr935 T A 9: 38,995,280 S52C probably damaging Het
Pkd1l3 A G 8: 109,648,261 probably null Het
Plcz1 A T 6: 140,023,156 D185E probably damaging Het
Plekhg5 C A 4: 152,112,528 Q757K possibly damaging Het
Prr23a2 T A 9: 98,856,974 D128E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sgsm1 A T 5: 113,268,846 probably null Het
Sh3bp5 C T 14: 31,378,289 V221M probably benign Het
Slc25a27 A T 17: 43,664,192 D59E probably benign Het
Slc35e1 G C 8: 72,492,514 R25G unknown Het
Slc4a4 T C 5: 89,170,751 V626A probably benign Het
Slfn5 T C 11: 82,956,703 L138P probably damaging Het
Stat1 A G 1: 52,126,621 probably null Het
Tnks2 G T 19: 36,852,536 A206S probably damaging Het
Trav7-1 C A 14: 52,655,064 Q25K probably benign Het
Ttn A G 2: 76,898,326 M5470T unknown Het
Vps35 A T 8: 85,274,967 D407E probably benign Het
Wdr90 T C 17: 25,860,702 D190G probably benign Het
Wdr93 T A 7: 79,773,355 F456I possibly damaging Het
Wdr95 A G 5: 149,606,293 E675G probably benign Het
Other mutations in Lrrc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Lrrc14b APN 13 74360959 missense probably damaging 0.97
IGL01521:Lrrc14b APN 13 74363572 missense probably damaging 1.00
IGL03156:Lrrc14b APN 13 74363904 missense probably benign
R0457:Lrrc14b UTSW 13 74361160 missense probably benign 0.41
R1631:Lrrc14b UTSW 13 74361254 splice site probably null
R1741:Lrrc14b UTSW 13 74363586 missense probably damaging 1.00
R2042:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2047:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2149:Lrrc14b UTSW 13 74363757 missense possibly damaging 0.63
R3083:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R3838:Lrrc14b UTSW 13 74363545 missense possibly damaging 0.86
R3892:Lrrc14b UTSW 13 74363668 missense probably benign 0.00
R5748:Lrrc14b UTSW 13 74363640 missense probably damaging 1.00
R6508:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R6663:Lrrc14b UTSW 13 74361361 missense probably damaging 1.00
R6687:Lrrc14b UTSW 13 74360762 missense probably benign 0.00
R7472:Lrrc14b UTSW 13 74363107 missense probably damaging 1.00
R7574:Lrrc14b UTSW 13 74360773 missense probably damaging 0.98
R7629:Lrrc14b UTSW 13 74361164 missense probably benign 0.03
R7695:Lrrc14b UTSW 13 74363178 missense possibly damaging 0.91
R8169:Lrrc14b UTSW 13 74363167 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CACATTCCCAGAGAACATTGTG -3'
(R):5'- GGCAGCTCCTACAAGTTCTTG -3'

Sequencing Primer
(F):5'- AGTGACTCCAGAATACTTTACCAGG -3'
(R):5'- ACAAGTTCTTGGCCTGGC -3'
Posted On2019-06-26