Incidental Mutation 'R7310:Itga10'
ID567482
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96648159 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 143 (A143D)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000156015] [ENSMUST00000165842]
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: A143D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: A143D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048766
SMART Domains Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118557
SMART Domains Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 8.3e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: A143D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: A143D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137564
AA Change: A328D
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447
AA Change: A328D

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156015
Predicted Effect probably benign
Transcript: ENSMUST00000165842
SMART Domains Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 3 237 8.9e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R7976:Itga10 UTSW 3 96649612 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCGTGGTAAGGGAAATTAGTC -3'
(R):5'- ACAGGAGCCTCTTCTGCAAG -3'

Sequencing Primer
(F):5'- TTCAAAACCCTAGAGAGCAAGG -3'
(R):5'- GAGCCTCTTCTGCAAGCACAC -3'
Posted On2019-06-26