Incidental Mutation 'R7310:Abcg3'
ID 567494
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 045409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 105114632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 295 (F295C)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: F295C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: F295C

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
AA Change: F295C

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: F295C

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,771,094 (GRCm39) Q192L possibly damaging Het
Abat G A 16: 8,423,457 (GRCm39) R250Q probably null Het
Abl1 T C 2: 31,690,604 (GRCm39) S708P possibly damaging Het
Acap2 A T 16: 30,926,972 (GRCm39) Y489* probably null Het
Akr1c6 A T 13: 4,486,354 (GRCm39) M54L probably benign Het
Arhgap5 A T 12: 52,589,270 (GRCm39) probably null Het
Asap1 A G 15: 63,971,379 (GRCm39) probably null Het
Atrnl1 A T 19: 57,630,856 (GRCm39) N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,795,485 (GRCm39) probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,795,460 (GRCm39) probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,795,451 (GRCm39) probably benign Het
Bmi1 T C 2: 18,689,230 (GRCm39) S305P probably benign Het
Bpifc T A 10: 85,798,891 (GRCm39) I431F probably damaging Het
C130050O18Rik A T 5: 139,400,993 (GRCm39) M349L probably benign Het
Cacna2d1 A T 5: 16,519,914 (GRCm39) D428V probably damaging Het
Card14 A C 11: 119,217,005 (GRCm39) Q363P probably null Het
Cdca2 A T 14: 67,950,673 (GRCm39) L86H probably damaging Het
Cdh22 G T 2: 164,954,214 (GRCm39) S769* probably null Het
Cdhr17 A G 5: 17,075,246 (GRCm39) Y872C possibly damaging Het
Cep164 T C 9: 45,686,664 (GRCm39) E690G probably damaging Het
Cluh A G 11: 74,560,285 (GRCm39) H1304R probably benign Het
Daxx C A 17: 34,129,435 (GRCm39) D5E possibly damaging Het
Dnah7c A G 1: 46,636,127 (GRCm39) M1117V possibly damaging Het
Entpd3 T A 9: 120,389,821 (GRCm39) probably null Het
Esr1 G A 10: 4,889,259 (GRCm39) A386T probably damaging Het
Etv5 G A 16: 22,220,487 (GRCm39) P300L probably benign Het
Exoc3l A T 8: 106,020,340 (GRCm39) L195Q probably damaging Het
Exog T C 9: 119,274,069 (GRCm39) L18P unknown Het
Fgfr1 T A 8: 26,052,331 (GRCm39) V219D probably benign Het
Gna14 A T 19: 16,511,113 (GRCm39) Q54L Het
Gnb5 T C 9: 75,221,570 (GRCm39) L48P probably benign Het
Gpbp1 A G 13: 111,589,924 (GRCm39) I57T probably benign Het
Hnrnpa1 T A 15: 103,149,884 (GRCm39) D48E probably damaging Het
Hrc T A 7: 44,985,227 (GRCm39) L126* probably null Het
Hspa8 T G 9: 40,714,704 (GRCm39) D333E probably benign Het
Igsf3 T A 3: 101,338,895 (GRCm39) V403D probably benign Het
Itga10 C A 3: 96,555,475 (GRCm39) A143D probably damaging Het
Kdr T A 5: 76,104,985 (GRCm39) I1082F probably damaging Het
Klk1b11 A T 7: 43,428,254 (GRCm39) I242F probably damaging Het
Kng2 G A 16: 22,806,522 (GRCm39) T559I probably benign Het
Map1b G A 13: 99,570,163 (GRCm39) P853S unknown Het
Mmp13 T C 9: 7,280,880 (GRCm39) I421T possibly damaging Het
Mpeg1 A T 19: 12,439,615 (GRCm39) T358S probably damaging Het
Msantd5l A C 11: 51,145,474 (GRCm39) W38G probably damaging Het
Mttp T C 3: 137,800,783 (GRCm39) D759G probably damaging Het
Mup17 T A 4: 61,511,929 (GRCm39) Y115F possibly damaging Het
Myo1a G T 10: 127,541,697 (GRCm39) A79S probably damaging Het
Myo9a T A 9: 59,778,436 (GRCm39) N1397K probably benign Het
Nadk2 T C 15: 9,103,469 (GRCm39) probably null Het
Ncf1 A T 5: 134,250,615 (GRCm39) S402T probably benign Het
Ndufb10 T C 17: 24,941,188 (GRCm39) D145G probably damaging Het
Nlgn2 G A 11: 69,721,409 (GRCm39) T163M possibly damaging Het
Nol4 A T 18: 22,903,801 (GRCm39) H172Q Het
Nup205 T A 6: 35,202,904 (GRCm39) D1370E possibly damaging Het
Or1e32 A C 11: 73,705,112 (GRCm39) N265K probably damaging Het
Or51ab3 T A 7: 103,201,892 (GRCm39) I300N probably damaging Het
Or5b97 A G 19: 12,878,637 (GRCm39) F169S probably damaging Het
Pkd1l2 A G 8: 117,750,773 (GRCm39) V1746A probably benign Het
Plin2 T A 4: 86,586,628 (GRCm39) I68F probably benign Het
Proc A T 18: 32,268,952 (GRCm39) M11K probably benign Het
Rif1 T C 2: 51,995,631 (GRCm39) V950A probably benign Het
Rmc1 A G 18: 12,317,972 (GRCm39) K362E probably benign Het
Rnf208 C A 2: 25,133,587 (GRCm39) P94T probably damaging Het
Rundc3b A T 5: 8,571,011 (GRCm39) Y269* probably null Het
Senp7 T C 16: 56,006,445 (GRCm39) V950A probably benign Het
Sipa1l1 T C 12: 82,419,269 (GRCm39) V649A probably damaging Het
Sipa1l3 G T 7: 29,099,121 (GRCm39) H383N probably benign Het
Slc12a5 G A 2: 164,834,360 (GRCm39) V794M probably damaging Het
Slc7a7 A G 14: 54,616,482 (GRCm39) I200T probably damaging Het
Spdye4b A C 5: 143,188,103 (GRCm39) I199L probably damaging Het
Styxl2 G A 1: 165,926,300 (GRCm39) T1104I possibly damaging Het
Tle4 A T 19: 14,495,155 (GRCm39) H191Q probably benign Het
Tnfsf13b C A 8: 10,081,651 (GRCm39) S271* probably null Het
Tnks2 G A 19: 36,856,839 (GRCm39) V855I probably benign Het
Trank1 T C 9: 111,196,194 (GRCm39) L1406S probably damaging Het
Trhde T C 10: 114,636,478 (GRCm39) E243G probably damaging Het
Trim25 A T 11: 88,906,608 (GRCm39) N448I probably benign Het
Trim31 T A 17: 37,218,194 (GRCm39) M308K probably benign Het
Ugt2b36 A T 5: 87,214,138 (GRCm39) V502E possibly damaging Het
Usp10 A C 8: 120,668,344 (GRCm39) D215A possibly damaging Het
Usp33 T G 3: 152,066,026 (GRCm39) L102* probably null Het
Wdr12 A T 1: 60,121,734 (GRCm39) C272* probably null Het
Xndc1 A C 7: 101,727,938 (GRCm39) probably null Het
Zkscan2 T C 7: 123,089,276 (GRCm39) I332V possibly damaging Het
Zswim5 A T 4: 116,841,885 (GRCm39) T822S probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATAAGCACCCGGAACTG -3'
(R):5'- GTGCTTGTCTTTACAGGAAGAG -3'

Sequencing Primer
(F):5'- GGAACTGACCAACAACAAAGTCTAC -3'
(R):5'- GAAAGAGTGTCCTCAGGT -3'
Posted On 2019-06-26