Incidental Mutation 'R0637:Cbr4'
Institutional Source Beutler Lab
Gene Symbol Cbr4
Ensembl Gene ENSMUSG00000031641
Gene Namecarbonyl reductase 4
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R0637 (G1)
Quality Score167
Status Validated
Chromosomal Location61487734-61506694 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 61490706 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034058] [ENSMUST00000126575]
Predicted Effect probably benign
Transcript: ENSMUST00000034058
SMART Domains Protein: ENSMUSP00000034058
Gene: ENSMUSG00000031641

Pfam:adh_short 3 192 2.4e-54 PFAM
Pfam:KR 4 182 6.5e-18 PFAM
Pfam:adh_short_C2 9 233 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126575
SMART Domains Protein: ENSMUSP00000117069
Gene: ENSMUSG00000031641

Pfam:adh_short 3 108 9.4e-20 PFAM
Pfam:KR 4 92 3.1e-10 PFAM
Pfam:adh_short_C2 9 110 1.1e-8 PFAM
low complexity region 117 128 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gars G A 6: 55,069,487 probably null Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Cbr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Cbr4 APN 8 61503211 makesense probably null
R0498:Cbr4 UTSW 8 61495073 missense probably benign 0.00
R1609:Cbr4 UTSW 8 61503158 missense probably damaging 1.00
R4168:Cbr4 UTSW 8 61491521 intron probably benign
R4709:Cbr4 UTSW 8 61490027 missense possibly damaging 0.66
R4802:Cbr4 UTSW 8 61490079 intron probably benign
R5049:Cbr4 UTSW 8 61495204 critical splice donor site probably null
R5876:Cbr4 UTSW 8 61490593 missense possibly damaging 0.78
R6020:Cbr4 UTSW 8 61487853 missense probably benign 0.44
R7818:Cbr4 UTSW 8 61487942 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccacactccctaatccttcc -3'
Posted On2013-07-11