Incidental Mutation 'R7310:Myo1a'
ID567521
Institutional Source Beutler Lab
Gene Symbol Myo1a
Ensembl Gene ENSMUSG00000025401
Gene Namemyosin IA
Synonymsbrush border myosin 1, BBM-I, Myhl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127705170-127720940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127705828 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 79 (A79S)
Ref Sequence ENSEMBL: ENSMUSP00000078540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000079590]
Predicted Effect probably benign
Transcript: ENSMUST00000048099
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079590
AA Change: A79S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078540
Gene: ENSMUSG00000025401
AA Change: A79S

DomainStartEndE-ValueType
MYSc 3 695 N/A SMART
IQ 696 718 1.27e-3 SMART
IQ 719 741 1.09e-2 SMART
IQ 742 764 7.52e-6 SMART
Pfam:Myosin_TH1 847 1035 1.4e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display abnormal small intestine brush border morphology, but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Myo1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Myo1a APN 10 127720660 missense probably benign 0.00
IGL01896:Myo1a APN 10 127719904 missense probably benign
IGL02073:Myo1a APN 10 127710225 missense probably damaging 0.98
IGL02380:Myo1a APN 10 127714485 missense probably benign 0.00
IGL02507:Myo1a APN 10 127712609 missense probably damaging 0.98
R0106:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0326:Myo1a UTSW 10 127716297 missense probably benign 0.00
R0357:Myo1a UTSW 10 127710902 missense probably benign 0.02
R0485:Myo1a UTSW 10 127719242 splice site probably benign
R0676:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0707:Myo1a UTSW 10 127719863 unclassified probably benign
R1241:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1441:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1458:Myo1a UTSW 10 127719937 missense probably benign
R1546:Myo1a UTSW 10 127712624 missense probably damaging 1.00
R1692:Myo1a UTSW 10 127719334 synonymous probably null
R1871:Myo1a UTSW 10 127719671 missense probably benign
R2067:Myo1a UTSW 10 127705478 missense probably benign 0.25
R2079:Myo1a UTSW 10 127720613 missense probably benign 0.00
R2151:Myo1a UTSW 10 127720181 missense probably benign 0.18
R2375:Myo1a UTSW 10 127705290 missense probably damaging 1.00
R3014:Myo1a UTSW 10 127716345 missense probably damaging 1.00
R3741:Myo1a UTSW 10 127714898 missense probably benign 0.19
R3812:Myo1a UTSW 10 127707415 missense possibly damaging 0.89
R4303:Myo1a UTSW 10 127713733 missense probably benign 0.10
R4306:Myo1a UTSW 10 127714081 missense probably benign
R4472:Myo1a UTSW 10 127710458 missense probably benign 0.06
R4599:Myo1a UTSW 10 127720151 unclassified probably null
R4604:Myo1a UTSW 10 127711138 missense probably damaging 1.00
R4649:Myo1a UTSW 10 127710217 missense probably benign 0.05
R4747:Myo1a UTSW 10 127714438 missense probably damaging 1.00
R4755:Myo1a UTSW 10 127715688 missense probably damaging 1.00
R4972:Myo1a UTSW 10 127716309 missense probably benign 0.31
R5072:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5073:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5074:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5386:Myo1a UTSW 10 127705897 nonsense probably null
R5592:Myo1a UTSW 10 127714039 missense probably damaging 1.00
R5619:Myo1a UTSW 10 127718544 missense probably benign 0.00
R6001:Myo1a UTSW 10 127706925 critical splice donor site probably null
R6374:Myo1a UTSW 10 127707680 missense probably damaging 1.00
R6577:Myo1a UTSW 10 127715320 missense possibly damaging 0.94
R6932:Myo1a UTSW 10 127710458 missense probably benign 0.06
R7395:Myo1a UTSW 10 127710440 missense probably damaging 0.98
R7429:Myo1a UTSW 10 127706847 missense probably damaging 1.00
R7430:Myo1a UTSW 10 127706847 missense probably damaging 1.00
X0067:Myo1a UTSW 10 127713745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGCCTCACATGTGA -3'
(R):5'- AGGCCTGGCTTGGAGAGAT -3'

Sequencing Primer
(F):5'- GGCTGACAAATGTCCATGAAGCATC -3'
(R):5'- CCTGGCTTGGAGAGATAAGGAG -3'
Posted On2019-06-26