Incidental Mutation 'R7310:Cdca2'
ID567535
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Namecell division cycle associated 2
Synonyms2610311M19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110162, NM_175384

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location67676331-67715841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67713224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 86 (L86H)
Ref Sequence ENSEMBL: ENSMUSP00000117847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000124045] [ENSMUST00000125212] [ENSMUST00000132705] [ENSMUST00000145542] [ENSMUST00000150006] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700] [ENSMUST00000163100]
Predicted Effect probably benign
Transcript: ENSMUST00000078053
SMART Domains Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 3.5e-22 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 253 292 1e-14 PFAM
Pfam:Pentapeptide_4 258 334 2.7e-15 PFAM
Pfam:Pentapeptide 288 327 6.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124045
AA Change: L86H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000125212
Predicted Effect probably damaging
Transcript: ENSMUST00000132705
AA Change: L86H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: L86H

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145542
Predicted Effect probably damaging
Transcript: ENSMUST00000150006
AA Change: L86H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: L86H

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150768
SMART Domains Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:KHA 2 64 1.4e-21 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 219 255 9.3e-8 PFAM
Pfam:Pentapeptide 248 280 9.3e-11 PFAM
Pfam:Pentapeptide 258 297 3e-10 PFAM
Pfam:Pentapeptide 303 342 3.2e-13 PFAM
Pfam:Pentapeptide_4 308 384 3.3e-13 PFAM
Pfam:Pentapeptide 338 377 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152243
SMART Domains Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:BTB_2 1 70 1.3e-13 PFAM
Pfam:BTB 1 78 6.2e-7 PFAM
Pfam:Pentapeptide 105 137 4.3e-8 PFAM
Pfam:Pentapeptide 134 166 5.5e-11 PFAM
Pfam:Pentapeptide 144 183 1.5e-10 PFAM
Pfam:Pentapeptide_4 165 239 5.3e-9 PFAM
Pfam:Pentapeptide 189 228 1.7e-13 PFAM
Pfam:Pentapeptide 209 237 9.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156700
SMART Domains Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 2.5e-23 PFAM
SCOP:d3kvt__ 89 107 9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163100
AA Change: L86H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: L86H

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0368:Cdca2 UTSW 14 67700347 missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4043:Cdca2 UTSW 14 67704006 missense probably benign 0.11
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67713140 missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6866:Cdca2 UTSW 14 67693666 missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
R7080:Cdca2 UTSW 14 67698102 missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67707351 critical splice donor site probably null
R7292:Cdca2 UTSW 14 67677877 nonsense probably null
R7308:Cdca2 UTSW 14 67694991 missense probably benign
R7877:Cdca2 UTSW 14 67677216 missense probably benign
R7960:Cdca2 UTSW 14 67677216 missense probably benign
R8012:Cdca2 UTSW 14 67677372 missense probably benign 0.23
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67680244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTTCACAAGACCCACGAG -3'
(R):5'- TGTGTGCCAAGTGCTGATC -3'

Sequencing Primer
(F):5'- GAGAGCACAGCCTTCTTT -3'
(R):5'- TGTGCCAAGTGCTGATCTAGAAAC -3'
Posted On2019-06-26