Incidental Mutation 'R7310:Asap1'
ID567537
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
MMRRC Submission
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 64099530 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect probably null
Transcript: ENSMUST00000023008
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110114
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110115
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175793
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175799
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176014
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176384
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177035
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177083
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177371
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177374
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5493:Asap1 UTSW 15 64130151 missense possibly damaging 0.85
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R5790:Asap1 UTSW 15 64094265 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6194:Asap1 UTSW 15 64129209 missense probably damaging 1.00
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7218:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7305:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7439:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7441:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7488:Asap1 UTSW 15 64120125 missense probably benign 0.29
R7597:Asap1 UTSW 15 64312455 missense probably benign 0.37
R7708:Asap1 UTSW 15 64152872 missense probably damaging 1.00
R7871:Asap1 UTSW 15 64092076 missense probably damaging 1.00
R7990:Asap1 UTSW 15 64172737 splice site probably null
R8163:Asap1 UTSW 15 64092050 missense probably damaging 1.00
R8171:Asap1 UTSW 15 64110966 missense probably damaging 1.00
R8416:Asap1 UTSW 15 64130223 missense possibly damaging 0.83
R8778:Asap1 UTSW 15 64127409 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTATAGTGACAGATTCAGGCTTTAC -3'
(R):5'- TTCTCCATCTGGACCAGACAAC -3'

Sequencing Primer
(F):5'- GTGACAGATTCAGGCTTTACTTTCTC -3'
(R):5'- TCTACATAGTGAGTTCCAGGCCAG -3'
Posted On2019-06-26