Incidental Mutation 'R7310:3110002H16Rik'
ID567547
Institutional Source Beutler Lab
Gene Symbol 3110002H16Rik
Ensembl Gene ENSMUSG00000024410
Gene NameRIKEN cDNA 3110002H16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12168717-12189997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12184915 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 362 (K362E)
Ref Sequence ENSEMBL: ENSMUSP00000025276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000025279] [ENSMUST00000134046] [ENSMUST00000138866]
Predicted Effect probably benign
Transcript: ENSMUST00000025276
AA Change: K362E

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410
AA Change: K362E

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025279
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000134046
SMART Domains Protein: ENSMUSP00000118783
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138866
AA Change: E124G
SMART Domains Protein: ENSMUSP00000121414
Gene: ENSMUSG00000024410
AA Change: E124G

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
Atrnl1 A T 19: 57,642,424 N208Y possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in 3110002H16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:3110002H16Rik APN 18 12179219 missense probably benign 0.00
IGL01883:3110002H16Rik APN 18 12178239 missense probably benign 0.03
IGL01956:3110002H16Rik APN 18 12189350 missense probably damaging 0.99
IGL02828:3110002H16Rik APN 18 12189221 missense possibly damaging 0.52
IGL03147:3110002H16Rik APN 18 12169229 splice site probably benign
R0147:3110002H16Rik UTSW 18 12189271 missense probably damaging 0.99
R0357:3110002H16Rik UTSW 18 12179209 missense possibly damaging 0.87
R1108:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1422:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1939:3110002H16Rik UTSW 18 12180505 missense probably damaging 1.00
R4300:3110002H16Rik UTSW 18 12188862 missense probably benign 0.00
R4826:3110002H16Rik UTSW 18 12185779 intron probably benign
R5103:3110002H16Rik UTSW 18 12189262 missense probably benign
R5345:3110002H16Rik UTSW 18 12179177 missense probably benign
R5506:3110002H16Rik UTSW 18 12188956 unclassified probably benign
R5566:3110002H16Rik UTSW 18 12180692 missense possibly damaging 0.90
R5574:3110002H16Rik UTSW 18 12185006 frame shift probably null
R5632:3110002H16Rik UTSW 18 12171583 missense possibly damaging 0.63
R6331:3110002H16Rik UTSW 18 12180514 missense probably damaging 0.99
R6765:3110002H16Rik UTSW 18 12176146 missense possibly damaging 0.82
R6978:3110002H16Rik UTSW 18 12185747 missense probably benign
R7734:3110002H16Rik UTSW 18 12189263 missense possibly damaging 0.81
R7792:3110002H16Rik UTSW 18 12181599 missense probably damaging 1.00
R7830:3110002H16Rik UTSW 18 12168871 missense probably benign 0.16
R7885:3110002H16Rik UTSW 18 12189314 missense probably damaging 1.00
R7968:3110002H16Rik UTSW 18 12189314 missense probably damaging 1.00
R8047:3110002H16Rik UTSW 18 12180529 missense not run
X0062:3110002H16Rik UTSW 18 12179519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACACACTGACGCTAG -3'
(R):5'- GTACCATGATGTGCCCAGACAC -3'

Sequencing Primer
(F):5'- ACTGACGCTAGGACGAGATCTC -3'
(R):5'- TGTGCCCAGACACGGACAC -3'
Posted On2019-06-26