Incidental Mutation 'R7310:Atrnl1'
ID567555
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
SynonymsAlp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7310 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57642424 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 208 (N208Y)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077282
AA Change: N208Y

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: N208Y

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,880,268 Q192L possibly damaging Het
3110002H16Rik A G 18: 12,184,915 K362E probably benign Het
Abat G A 16: 8,605,593 R250Q probably null Het
Abcg3 A C 5: 104,966,766 F295C probably benign Het
Abl1 T C 2: 31,800,592 S708P possibly damaging Het
Acap2 A T 16: 31,108,154 Y489* probably null Het
Akr1c6 A T 13: 4,436,355 M54L probably benign Het
Arhgap5 A T 12: 52,542,487 probably null Het
Asap1 A G 15: 64,099,530 probably null Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 G GGGGTCACTGGTTCTT 3: 95,888,148 probably benign Het
BC028528 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG 3: 95,888,173 probably benign Het
BC049762 A C 11: 51,254,647 W38G probably damaging Het
Bmi1 T C 2: 18,684,419 S305P probably benign Het
Bpifc T A 10: 85,963,027 I431F probably damaging Het
C130050O18Rik A T 5: 139,415,238 M349L probably benign Het
Cacna2d1 A T 5: 16,314,916 D428V probably damaging Het
Card14 A C 11: 119,326,179 Q363P probably null Het
Cdca2 A T 14: 67,713,224 L86H probably damaging Het
Cdh22 G T 2: 165,112,294 S769* probably null Het
Cep164 T C 9: 45,775,366 E690G probably damaging Het
Cluh A G 11: 74,669,459 H1304R probably benign Het
Daxx C A 17: 33,910,461 D5E possibly damaging Het
Dnah7c A G 1: 46,596,967 M1117V possibly damaging Het
Dusp27 G A 1: 166,098,731 T1104I possibly damaging Het
Entpd3 T A 9: 120,560,755 probably null Het
Esr1 G A 10: 4,939,259 A386T probably damaging Het
Etv5 G A 16: 22,401,737 P300L probably benign Het
Exoc3l A T 8: 105,293,708 L195Q probably damaging Het
Exog T C 9: 119,445,003 L18P unknown Het
Fgfr1 T A 8: 25,562,315 V219D probably benign Het
Gm28710 A G 5: 16,870,248 Y872C possibly damaging Het
Gna14 A T 19: 16,533,749 Q54L Het
Gnb5 T C 9: 75,314,288 L48P probably benign Het
Gpbp1 A G 13: 111,453,390 I57T probably benign Het
Hnrnpa1 T A 15: 103,241,457 D48E probably damaging Het
Hrc T A 7: 45,335,803 L126* probably null Het
Hspa8 T G 9: 40,803,408 D333E probably benign Het
Igsf3 T A 3: 101,431,579 V403D probably benign Het
Itga10 C A 3: 96,648,159 A143D probably damaging Het
Kdr T A 5: 75,944,325 I1082F probably damaging Het
Klk11 A T 7: 43,778,830 I242F probably damaging Het
Kng2 G A 16: 22,987,772 T559I probably benign Het
Map1b G A 13: 99,433,655 P853S unknown Het
Mmp13 T C 9: 7,280,880 I421T possibly damaging Het
Mpeg1 A T 19: 12,462,251 T358S probably damaging Het
Mttp T C 3: 138,095,022 D759G probably damaging Het
Mup17 T A 4: 61,593,692 Y115F possibly damaging Het
Myo1a G T 10: 127,705,828 A79S probably damaging Het
Myo9a T A 9: 59,871,153 N1397K probably benign Het
Nadk2 T C 15: 9,103,381 probably null Het
Ncf1 A T 5: 134,221,761 S402T probably benign Het
Ndufb10 T C 17: 24,722,214 D145G probably damaging Het
Nlgn2 G A 11: 69,830,583 T163M possibly damaging Het
Nol4 A T 18: 22,770,744 H172Q Het
Nup205 T A 6: 35,225,969 D1370E possibly damaging Het
Olfr1447 A G 19: 12,901,273 F169S probably damaging Het
Olfr392 A C 11: 73,814,286 N265K probably damaging Het
Olfr613 T A 7: 103,552,685 I300N probably damaging Het
Pkd1l2 A G 8: 117,024,034 V1746A probably benign Het
Plin2 T A 4: 86,668,391 I68F probably benign Het
Proc A T 18: 32,135,899 M11K probably benign Het
Rif1 T C 2: 52,105,619 V950A probably benign Het
Rnf208 C A 2: 25,243,575 P94T probably damaging Het
Rundc3b A T 5: 8,521,011 Y269* probably null Het
Senp7 T C 16: 56,186,082 V950A probably benign Het
Sipa1l1 T C 12: 82,372,495 V649A probably damaging Het
Sipa1l3 G T 7: 29,399,696 H383N probably benign Het
Slc12a5 G A 2: 164,992,440 V794M probably damaging Het
Slc7a7 A G 14: 54,379,025 I200T probably damaging Het
Spdye4b A C 5: 143,202,348 I199L probably damaging Het
Tle4 A T 19: 14,517,791 H191Q probably benign Het
Tnfsf13b C A 8: 10,031,651 S271* probably null Het
Tnks2 G A 19: 36,879,439 V855I probably benign Het
Trank1 T C 9: 111,367,126 L1406S probably damaging Het
Trhde T C 10: 114,800,573 E243G probably damaging Het
Trim25 A T 11: 89,015,782 N448I probably benign Het
Trim31 T A 17: 36,907,302 M308K probably benign Het
Ugt2b36 A T 5: 87,066,279 V502E possibly damaging Het
Usp10 A C 8: 119,941,605 D215A possibly damaging Het
Usp33 T G 3: 152,360,389 L102* probably null Het
Wdr12 A T 1: 60,082,575 C272* probably null Het
Xndc1 A C 7: 102,078,731 probably null Het
Zkscan2 T C 7: 123,490,053 I332V possibly damaging Het
Zswim5 A T 4: 116,984,688 T822S probably benign Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGCTTCAGACGTTGAGG -3'
(R):5'- AACTATCGTTGCAGACACAGAG -3'

Sequencing Primer
(F):5'- GGAGCCCTTGAAATCAGAGTTTTG -3'
(R):5'- GTTGCAGACACAGAGTTTCTC -3'
Posted On2019-06-26