Incidental Mutation 'R7311:Scn9a'
ID 567565
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission 045367-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7311 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66310424-66465306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 66314748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1657 (A1657S)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably benign
Transcript: ENSMUST00000100063
AA Change: A1648S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: A1648S

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100064
AA Change: A1657S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: A1657S

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
AA Change: A1646S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: A1646S

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164384
AA Change: A1657S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: A1657S

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169900
AA Change: A1646S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: A1646S

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,635,184 (GRCm39) V118A probably benign Het
Accsl C T 2: 93,696,160 (GRCm39) G146D possibly damaging Het
Acsm1 A T 7: 119,237,305 (GRCm39) H206L probably damaging Het
Acta2 A G 19: 34,219,186 (GRCm39) Y339H probably damaging Het
Adcy2 T C 13: 68,779,073 (GRCm39) D989G probably damaging Het
Ahnak G A 19: 8,979,507 (GRCm39) A264T probably benign Het
Ahnak A G 19: 8,987,191 (GRCm39) D2825G possibly damaging Het
Akt1 G T 12: 112,623,587 (GRCm39) T291K probably damaging Het
Arhgap24 A G 5: 103,040,551 (GRCm39) D589G probably damaging Het
B4galnt3 G A 6: 120,192,396 (GRCm39) Q447* probably null Het
BC024063 C T 10: 81,945,993 (GRCm39) R538C possibly damaging Het
Bod1l A G 5: 41,951,676 (GRCm39) S2912P possibly damaging Het
Bysl A G 17: 47,912,710 (GRCm39) V360A possibly damaging Het
C1qb A G 4: 136,607,877 (GRCm39) V162A possibly damaging Het
Ccdc57 G A 11: 120,764,567 (GRCm39) P736L probably benign Het
Cep290 T A 10: 100,373,580 (GRCm39) F1287I probably damaging Het
Cntn1 T C 15: 92,130,156 (GRCm39) probably null Het
Col6a3 C T 1: 90,750,013 (GRCm39) G274R probably damaging Het
Cplane1 G T 15: 8,210,399 (GRCm39) V291F probably damaging Het
Cyb5r4 T C 9: 86,937,835 (GRCm39) C285R probably damaging Het
Cyp4f39 G A 17: 32,708,629 (GRCm39) C392Y probably damaging Het
Dcun1d3 A T 7: 119,458,734 (GRCm39) D100E probably damaging Het
Dhx58 A T 11: 100,588,997 (GRCm39) D516E probably benign Het
Dock5 T A 14: 68,065,951 (GRCm39) I351F probably benign Het
Elmod2 A C 8: 84,046,041 (GRCm39) probably null Het
Endov G A 11: 119,398,077 (GRCm39) A281T probably benign Het
Epyc A G 10: 97,485,562 (GRCm39) M1V probably null Het
Espnl T A 1: 91,251,290 (GRCm39) H128Q probably damaging Het
Fam20a A T 11: 109,565,454 (GRCm39) C452* probably null Het
Fam241b A G 10: 61,944,733 (GRCm39) V88A probably damaging Het
Fbxl9 A G 8: 106,042,299 (GRCm39) probably benign Het
Fgd3 A T 13: 49,450,166 (GRCm39) S28T possibly damaging Het
Fmn1 C A 2: 113,356,025 (GRCm39) P920Q unknown Het
Gpr139 G C 7: 118,744,089 (GRCm39) D165E probably benign Het
Hoxb1 A G 11: 96,257,927 (GRCm39) T286A possibly damaging Het
Ifi204 T A 1: 173,587,134 (GRCm39) E174D probably benign Het
Igf2bp2 A G 16: 21,880,632 (GRCm39) I555T possibly damaging Het
Ighv1-85 A G 12: 115,963,799 (GRCm39) I67T probably damaging Het
Ihh G C 1: 74,990,306 (GRCm39) P23R unknown Het
Irx2 T C 13: 72,779,396 (GRCm39) S227P probably damaging Het
Itga4 A G 2: 79,086,526 (GRCm39) I68V probably benign Het
Jsrp1 T A 10: 80,647,906 (GRCm39) T51S probably benign Het
Khdc4 T C 3: 88,619,002 (GRCm39) S569P probably damaging Het
Kifc2 G T 15: 76,547,010 (GRCm39) G306V probably damaging Het
L3mbtl2 T A 15: 81,551,588 (GRCm39) S85T possibly damaging Het
Lama1 T C 17: 68,074,380 (GRCm39) S944P Het
Lama4 T A 10: 38,902,631 (GRCm39) C202S probably damaging Het
Morc3 G A 16: 93,646,061 (GRCm39) D218N probably damaging Het
Mrtfb T A 16: 13,223,718 (GRCm39) Y866* probably null Het
Myorg A G 4: 41,498,577 (GRCm39) I351T probably damaging Het
N4bp2l1 G A 5: 150,496,389 (GRCm39) T179I probably damaging Het
Narf A G 11: 121,139,976 (GRCm39) E270G probably benign Het
Nsd2 A G 5: 34,049,380 (GRCm39) D1205G probably damaging Het
Or10x1 T C 1: 174,196,759 (GRCm39) V92A probably benign Het
Or5an11 T C 19: 12,246,068 (GRCm39) V158A probably benign Het
Parl T C 16: 20,106,625 (GRCm39) T195A probably benign Het
Phrf1 A G 7: 140,820,846 (GRCm39) I158V unknown Het
Phtf1 T C 3: 103,904,980 (GRCm39) F543L possibly damaging Het
Plod2 T A 9: 92,466,611 (GRCm39) D190E probably damaging Het
Polr1a G T 6: 71,927,863 (GRCm39) K871N possibly damaging Het
Ppp2r5a A T 1: 191,089,998 (GRCm39) I252K probably damaging Het
Ptgir T A 7: 16,640,973 (GRCm39) D88E probably damaging Het
Raly T C 2: 154,699,340 (GRCm39) V48A probably damaging Het
Ripor1 T A 8: 106,344,447 (GRCm39) L527* probably null Het
Rnf213 T C 11: 119,307,373 (GRCm39) S678P Het
Rpf1 T A 3: 146,212,918 (GRCm39) Q306L probably benign Het
Rpl14 T C 9: 120,403,171 (GRCm39) I122T probably damaging Het
Serpinb10 A G 1: 107,474,477 (GRCm39) Y213C probably damaging Het
Slc25a23 A G 17: 57,359,827 (GRCm39) L308P probably damaging Het
Smg9 T A 7: 24,120,058 (GRCm39) M387K probably benign Het
Socs3 G A 11: 117,858,614 (GRCm39) P148L probably benign Het
Susd3 A G 13: 49,401,906 (GRCm39) L14P probably benign Het
Syt14 T A 1: 192,662,858 (GRCm39) M80L probably benign Het
Tmprss2 T A 16: 97,369,616 (GRCm39) Y386F possibly damaging Het
Tmx3 T A 18: 90,558,195 (GRCm39) S416T probably benign Het
Treh A G 9: 44,597,245 (GRCm39) T555A probably benign Het
Ttc5 T G 14: 51,003,400 (GRCm39) Q428P probably damaging Het
Vmn2r73 A G 7: 85,521,192 (GRCm39) S259P possibly damaging Het
Vps4b A T 1: 106,719,434 (GRCm39) V38E probably damaging Het
Wdr83 C A 8: 85,802,890 (GRCm39) R177L probably benign Het
Zfp780b A G 7: 27,662,588 (GRCm39) F656L possibly damaging Het
Zfp995 A T 17: 22,099,641 (GRCm39) F198I probably benign Het
Zswim8 A T 14: 20,771,552 (GRCm39) Y1495F probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66,393,945 (GRCm39) missense probably damaging 1.00
IGL00570:Scn9a APN 2 66,314,486 (GRCm39) missense probably damaging 1.00
IGL00809:Scn9a APN 2 66,314,279 (GRCm39) missense probably damaging 1.00
IGL00977:Scn9a APN 2 66,314,645 (GRCm39) missense probably damaging 0.99
IGL01120:Scn9a APN 2 66,357,316 (GRCm39) missense probably benign 0.00
IGL01134:Scn9a APN 2 66,335,312 (GRCm39) missense probably damaging 1.00
IGL01300:Scn9a APN 2 66,318,397 (GRCm39) nonsense probably null
IGL01452:Scn9a APN 2 66,357,416 (GRCm39) missense probably damaging 1.00
IGL01531:Scn9a APN 2 66,367,722 (GRCm39) missense probably benign 0.11
IGL01572:Scn9a APN 2 66,324,230 (GRCm39) missense probably benign 0.00
IGL01645:Scn9a APN 2 66,317,986 (GRCm39) missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66,314,386 (GRCm39) missense probably damaging 1.00
IGL01965:Scn9a APN 2 66,314,777 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,325,170 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,377,479 (GRCm39) missense probably damaging 1.00
IGL02166:Scn9a APN 2 66,323,447 (GRCm39) missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66,314,955 (GRCm39) splice site probably benign
IGL02640:Scn9a APN 2 66,366,440 (GRCm39) critical splice donor site probably null
IGL02685:Scn9a APN 2 66,367,637 (GRCm39) missense probably damaging 1.00
IGL02798:Scn9a APN 2 66,370,903 (GRCm39) missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66,398,373 (GRCm39) missense probably damaging 1.00
IGL03008:Scn9a APN 2 66,392,855 (GRCm39) missense probably damaging 1.00
IGL03270:Scn9a APN 2 66,314,358 (GRCm39) missense probably damaging 1.00
IGL03408:Scn9a APN 2 66,357,091 (GRCm39) missense probably benign 0.00
BB007:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
BB017:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R0039:Scn9a UTSW 2 66,392,788 (GRCm39) missense probably damaging 0.98
R0173:Scn9a UTSW 2 66,363,437 (GRCm39) missense probably damaging 1.00
R0323:Scn9a UTSW 2 66,398,475 (GRCm39) missense probably damaging 1.00
R0344:Scn9a UTSW 2 66,335,354 (GRCm39) missense probably damaging 0.99
R0421:Scn9a UTSW 2 66,373,621 (GRCm39) missense probably benign
R0465:Scn9a UTSW 2 66,357,340 (GRCm39) missense probably damaging 1.00
R0514:Scn9a UTSW 2 66,314,022 (GRCm39) missense probably damaging 1.00
R0599:Scn9a UTSW 2 66,357,143 (GRCm39) missense probably damaging 0.96
R0627:Scn9a UTSW 2 66,367,721 (GRCm39) missense probably benign 0.00
R0644:Scn9a UTSW 2 66,363,405 (GRCm39) critical splice donor site probably null
R0653:Scn9a UTSW 2 66,363,721 (GRCm39) missense probably damaging 1.00
R0685:Scn9a UTSW 2 66,313,843 (GRCm39) missense probably benign 0.02
R0718:Scn9a UTSW 2 66,377,456 (GRCm39) missense probably damaging 1.00
R0827:Scn9a UTSW 2 66,366,468 (GRCm39) nonsense probably null
R0890:Scn9a UTSW 2 66,314,079 (GRCm39) missense probably damaging 1.00
R1139:Scn9a UTSW 2 66,335,341 (GRCm39) missense probably benign 0.02
R1385:Scn9a UTSW 2 66,393,886 (GRCm39) missense probably damaging 1.00
R1398:Scn9a UTSW 2 66,314,930 (GRCm39) missense probably benign 0.11
R1496:Scn9a UTSW 2 66,357,232 (GRCm39) missense probably benign
R1511:Scn9a UTSW 2 66,357,157 (GRCm39) missense probably benign 0.01
R1517:Scn9a UTSW 2 66,335,371 (GRCm39) splice site probably benign
R1564:Scn9a UTSW 2 66,314,648 (GRCm39) missense probably damaging 1.00
R1634:Scn9a UTSW 2 66,318,361 (GRCm39) missense probably damaging 1.00
R1662:Scn9a UTSW 2 66,313,803 (GRCm39) missense probably benign 0.00
R1695:Scn9a UTSW 2 66,335,220 (GRCm39) nonsense probably null
R1709:Scn9a UTSW 2 66,313,850 (GRCm39) missense probably damaging 1.00
R1741:Scn9a UTSW 2 66,317,938 (GRCm39) missense probably damaging 0.99
R1755:Scn9a UTSW 2 66,332,060 (GRCm39) missense probably benign 0.38
R1914:Scn9a UTSW 2 66,396,594 (GRCm39) missense probably damaging 1.00
R1962:Scn9a UTSW 2 66,314,655 (GRCm39) missense probably damaging 1.00
R1970:Scn9a UTSW 2 66,345,724 (GRCm39) missense probably damaging 0.97
R2017:Scn9a UTSW 2 66,345,665 (GRCm39) missense probably damaging 0.99
R2092:Scn9a UTSW 2 66,363,720 (GRCm39) missense probably damaging 0.99
R2105:Scn9a UTSW 2 66,398,527 (GRCm39) missense probably benign 0.25
R2114:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2115:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2128:Scn9a UTSW 2 66,356,998 (GRCm39) missense probably damaging 1.00
R2157:Scn9a UTSW 2 66,366,669 (GRCm39) missense probably damaging 1.00
R2162:Scn9a UTSW 2 66,364,573 (GRCm39) missense probably damaging 0.98
R2350:Scn9a UTSW 2 66,335,312 (GRCm39) missense probably damaging 1.00
R3694:Scn9a UTSW 2 66,392,749 (GRCm39) missense probably benign
R3771:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3772:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3773:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3922:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66,395,398 (GRCm39) intron probably benign
R4385:Scn9a UTSW 2 66,314,900 (GRCm39) missense probably damaging 1.00
R4415:Scn9a UTSW 2 66,357,037 (GRCm39) missense probably damaging 1.00
R4570:Scn9a UTSW 2 66,313,902 (GRCm39) missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66,377,362 (GRCm39) missense probably benign
R4783:Scn9a UTSW 2 66,370,967 (GRCm39) missense probably benign 0.01
R4822:Scn9a UTSW 2 66,314,093 (GRCm39) missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66,382,057 (GRCm39) missense probably benign
R4908:Scn9a UTSW 2 66,357,087 (GRCm39) missense probably benign 0.03
R4983:Scn9a UTSW 2 66,396,614 (GRCm39) missense probably benign 0.02
R5047:Scn9a UTSW 2 66,392,824 (GRCm39) missense probably damaging 1.00
R5100:Scn9a UTSW 2 66,364,463 (GRCm39) missense probably damaging 1.00
R5140:Scn9a UTSW 2 66,395,511 (GRCm39) missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66,318,387 (GRCm39) missense probably damaging 1.00
R5557:Scn9a UTSW 2 66,377,447 (GRCm39) missense probably damaging 0.99
R5582:Scn9a UTSW 2 66,395,373 (GRCm39) intron probably benign
R6108:Scn9a UTSW 2 66,314,393 (GRCm39) missense probably damaging 1.00
R6115:Scn9a UTSW 2 66,393,973 (GRCm39) missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66,317,868 (GRCm39) missense probably benign 0.00
R6261:Scn9a UTSW 2 66,314,240 (GRCm39) missense probably damaging 1.00
R6335:Scn9a UTSW 2 66,398,608 (GRCm39) start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66,357,307 (GRCm39) missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66,313,846 (GRCm39) missense probably benign 0.23
R6681:Scn9a UTSW 2 66,393,686 (GRCm39) missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66,398,373 (GRCm39) missense probably damaging 1.00
R7102:Scn9a UTSW 2 66,379,359 (GRCm39) missense probably damaging 1.00
R7186:Scn9a UTSW 2 66,364,567 (GRCm39) missense probably damaging 1.00
R7243:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R7328:Scn9a UTSW 2 66,314,931 (GRCm39) missense probably benign
R7386:Scn9a UTSW 2 66,370,894 (GRCm39) missense probably damaging 1.00
R7438:Scn9a UTSW 2 66,377,531 (GRCm39) missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66,363,692 (GRCm39) missense probably damaging 0.99
R7485:Scn9a UTSW 2 66,364,561 (GRCm39) missense probably damaging 1.00
R7526:Scn9a UTSW 2 66,313,990 (GRCm39) missense probably benign
R7617:Scn9a UTSW 2 66,370,893 (GRCm39) missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66,366,580 (GRCm39) missense probably benign 0.02
R7653:Scn9a UTSW 2 66,357,424 (GRCm39) missense probably damaging 1.00
R7747:Scn9a UTSW 2 66,314,642 (GRCm39) missense probably damaging 1.00
R7823:Scn9a UTSW 2 66,314,135 (GRCm39) missense probably damaging 1.00
R7864:Scn9a UTSW 2 66,314,904 (GRCm39) missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66,373,456 (GRCm39) missense probably benign 0.00
R7930:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R7975:Scn9a UTSW 2 66,314,597 (GRCm39) missense probably damaging 1.00
R8057:Scn9a UTSW 2 66,345,774 (GRCm39) missense probably benign 0.06
R8145:Scn9a UTSW 2 66,317,754 (GRCm39) missense probably damaging 1.00
R8163:Scn9a UTSW 2 66,314,745 (GRCm39) missense probably damaging 1.00
R8165:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R8342:Scn9a UTSW 2 66,366,626 (GRCm39) missense probably benign
R8345:Scn9a UTSW 2 66,324,966 (GRCm39) missense probably damaging 0.96
R8464:Scn9a UTSW 2 66,396,625 (GRCm39) missense probably damaging 0.99
R8467:Scn9a UTSW 2 66,332,015 (GRCm39) missense probably damaging 1.00
R8698:Scn9a UTSW 2 66,366,628 (GRCm39) missense probably benign 0.00
R8810:Scn9a UTSW 2 66,332,010 (GRCm39) missense probably damaging 1.00
R8822:Scn9a UTSW 2 66,370,979 (GRCm39) missense probably damaging 0.99
R8829:Scn9a UTSW 2 66,313,961 (GRCm39) missense probably benign
R9009:Scn9a UTSW 2 66,338,927 (GRCm39) missense probably damaging 1.00
R9038:Scn9a UTSW 2 66,325,147 (GRCm39) missense probably damaging 1.00
R9126:Scn9a UTSW 2 66,314,744 (GRCm39) missense probably damaging 1.00
R9205:Scn9a UTSW 2 66,363,657 (GRCm39) missense probably damaging 1.00
R9300:Scn9a UTSW 2 66,335,236 (GRCm39) missense probably benign 0.39
R9373:Scn9a UTSW 2 66,314,261 (GRCm39) missense probably benign 0.00
R9404:Scn9a UTSW 2 66,357,040 (GRCm39) missense probably benign 0.02
R9443:Scn9a UTSW 2 66,395,553 (GRCm39) missense probably damaging 1.00
R9590:Scn9a UTSW 2 66,314,328 (GRCm39) missense probably benign 0.05
R9612:Scn9a UTSW 2 66,363,708 (GRCm39) missense probably damaging 1.00
R9617:Scn9a UTSW 2 66,392,809 (GRCm39) missense probably damaging 1.00
R9717:Scn9a UTSW 2 66,357,002 (GRCm39) missense probably benign
X0003:Scn9a UTSW 2 66,338,991 (GRCm39) missense probably benign 0.02
X0062:Scn9a UTSW 2 66,398,421 (GRCm39) missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66,370,936 (GRCm39) missense probably benign 0.00
Z1177:Scn9a UTSW 2 66,325,029 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CACTGAACTTCCTGGGTGAAC -3'
(R):5'- AGGAATGTTTCTCGCTGAGATG -3'

Sequencing Primer
(F):5'- ACAGGCAGATCATGCTGT -3'
(R):5'- TTTCTCGCTGAGATGATAGAGAAG -3'
Posted On 2019-06-26