Mutagenetix > Incidental Mutations

Incidental Mutation 'R7311:Scn9a'

567565

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7311 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 66484404 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1657 (A1657S)

Ref Sequence

ENSEMBL: ENSMUSP00000097642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

Predicted Effect

probably benign
Transcript: ENSMUST00000100063
AA Change: A1648S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: A1648S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100064
AA Change: A1657S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: A1657S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112354
AA Change: A1646S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: A1646S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164384
AA Change: A1657S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: A1657S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169900
AA Change: A1646S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: A1646S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	A	G	12: 110,668,750	V118A	probably benign	Het
2410089E03Rik	G	T	15: 8,180,915	V291F	probably damaging	Het
2810403A07Rik	T	C	3: 88,711,695	S569P	probably damaging	Het
Accsl	C	T	2: 93,865,815	G146D	possibly damaging	Het
Acsm1	A	T	7: 119,638,082	H206L	probably damaging	Het
Acta2	A	G	19: 34,241,786	Y339H	probably damaging	Het
Adcy2	T	C	13: 68,630,954	D989G	probably damaging	Het
Ahnak	G	A	19: 9,002,143	A264T	probably benign	Het
Ahnak	A	G	19: 9,009,827	D2825G	possibly damaging	Het
AI464131	A	G	4: 41,498,577	I351T	probably damaging	Het
Akt1	G	T	12: 112,657,153	T291K	probably damaging	Het
Arhgap24	A	G	5: 102,892,685	D589G	probably damaging	Het
B4galnt3	G	A	6: 120,215,435	Q447*	probably null	Het
BC024063	C	T	10: 82,110,159	R538C	possibly damaging	Het
Bod1l	A	G	5: 41,794,333	S2912P	possibly damaging	Het
Bysl	A	G	17: 47,601,785	V360A	possibly damaging	Het
C1qb	A	G	4: 136,880,566	V162A	possibly damaging	Het
Ccdc57	G	A	11: 120,873,741	P736L	probably benign	Het
Cep290	T	A	10: 100,537,718	F1287I	probably damaging	Het
Cntn1	T	C	15: 92,232,275		probably null	Het
Col6a3	C	T	1: 90,822,291	G274R	probably damaging	Het
Cyb5r4	T	C	9: 87,055,782	C285R	probably damaging	Het
Cyp4f39	G	A	17: 32,489,655	C392Y	probably damaging	Het
Dcun1d3	A	T	7: 119,859,511	D100E	probably damaging	Het
Dhx58	A	T	11: 100,698,171	D516E	probably benign	Het
Dock5	T	A	14: 67,828,502	I351F	probably benign	Het
Elmod2	A	C	8: 83,319,412		probably null	Het
Endov	G	A	11: 119,507,251	A281T	probably benign	Het
Epyc	A	G	10: 97,649,700	M1V	probably null	Het
Espnl	T	A	1: 91,323,568	H128Q	probably damaging	Het
Fam20a	A	T	11: 109,674,628	C452*	probably null	Het
Fam241b	A	G	10: 62,108,954	V88A	probably damaging	Het
Fgd3	A	T	13: 49,296,690	S28T	possibly damaging	Het
Fmn1	C	A	2: 113,525,680	P920Q	unknown	Het
Gpr139	G	C	7: 119,144,866	D165E	probably benign	Het
Hoxb1	A	G	11: 96,367,101	T286A	possibly damaging	Het
Ifi204	T	A	1: 173,759,568	E174D	probably benign	Het
Igf2bp2	A	G	16: 22,061,882	I555T	possibly damaging	Het
Ighv1-85	A	G	12: 116,000,179	I67T	probably damaging	Het
Ihh	G	C	1: 74,951,147	P23R	unknown	Het
Irx2	T	C	13: 72,631,277	S227P	probably damaging	Het
Itga4	A	G	2: 79,256,182	I68V	probably benign	Het
Jsrp1	T	A	10: 80,812,072	T51S	probably benign	Het
Kifc2	G	T	15: 76,662,810	G306V	probably damaging	Het
L3mbtl2	T	A	15: 81,667,387	S85T	possibly damaging	Het
Lama1	T	C	17: 67,767,385	S944P		Het
Lama4	T	A	10: 39,026,635	C202S	probably damaging	Het
Lrrc29	A	G	8: 105,315,667		probably benign	Het
Mkl2	T	A	16: 13,405,854	Y866*	probably null	Het
Morc3	G	A	16: 93,849,173	D218N	probably damaging	Het
N4bp2l1	G	A	5: 150,572,924	T179I	probably damaging	Het
Narf	A	G	11: 121,249,150	E270G	probably benign	Het
Nsd2	A	G	5: 33,892,036	D1205G	probably damaging	Het
Olfr235	T	C	19: 12,268,704	V158A	probably benign	Het
Olfr417	T	C	1: 174,369,193	V92A	probably benign	Het
Parl	T	C	16: 20,287,875	T195A	probably benign	Het
Phrf1	A	G	7: 141,240,933	I158V	unknown	Het
Phtf1	T	C	3: 103,997,664	F543L	possibly damaging	Het
Plod2	T	A	9: 92,584,558	D190E	probably damaging	Het
Polr1a	G	T	6: 71,950,879	K871N	possibly damaging	Het
Ppp2r5a	A	T	1: 191,357,801	I252K	probably damaging	Het
Ptgir	T	A	7: 16,907,048	D88E	probably damaging	Het
Raly	T	C	2: 154,857,420	V48A	probably damaging	Het
Ripor1	T	A	8: 105,617,815	L527*	probably null	Het
Rnf213	T	C	11: 119,416,547	S678P		Het
Rpf1	T	A	3: 146,507,163	Q306L	probably benign	Het
Rpl14	T	C	9: 120,574,105	I122T	probably damaging	Het
Serpinb10	A	G	1: 107,546,747	Y213C	probably damaging	Het
Slc25a23	A	G	17: 57,052,827	L308P	probably damaging	Het
Smg9	T	A	7: 24,420,633	M387K	probably benign	Het
Socs3	G	A	11: 117,967,788	P148L	probably benign	Het
Susd3	A	G	13: 49,248,430	L14P	probably benign	Het
Syt14	T	A	1: 192,980,550	M80L	probably benign	Het
Tmprss2	T	A	16: 97,568,416	Y386F	possibly damaging	Het
Tmx3	T	A	18: 90,540,071	S416T	probably benign	Het
Treh	A	G	9: 44,685,948	T555A	probably benign	Het
Ttc5	T	G	14: 50,765,943	Q428P	probably damaging	Het
Vmn2r73	A	G	7: 85,871,984	S259P	possibly damaging	Het
Vps4b	A	T	1: 106,791,704	V38E	probably damaging	Het
Wdr83	C	A	8: 85,076,261	R177L	probably benign	Het
Zfp780b	A	G	7: 27,963,163	F656L	possibly damaging	Het
Zfp995	A	T	17: 21,880,660	F198I	probably benign	Het
Zswim8	A	T	14: 20,721,484	Y1495F	probably damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGAACTTCCTGGGTGAAC -3'
(R):5'- AGGAATGTTTCTCGCTGAGATG -3'

Sequencing Primer
(F):5'- ACAGGCAGATCATGCTGT -3'
(R):5'- TTTCTCGCTGAGATGATAGAGAAG -3'

Posted On

2019-06-26