Mutagenetix > Incidental Mutation

Incidental Mutation 'R7311:Polr1a'

567579

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

045367-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7311 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 71950879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 871 (K871N)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

AlphaFold

O35134

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055296
AA Change: K871N

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: K871N

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206513

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	A	G	12: 110,668,750	V118A	probably benign	Het
2410089E03Rik	G	T	15: 8,180,915	V291F	probably damaging	Het
2810403A07Rik	T	C	3: 88,711,695	S569P	probably damaging	Het
Accsl	C	T	2: 93,865,815	G146D	possibly damaging	Het
Acsm1	A	T	7: 119,638,082	H206L	probably damaging	Het
Acta2	A	G	19: 34,241,786	Y339H	probably damaging	Het
Adcy2	T	C	13: 68,630,954	D989G	probably damaging	Het
Ahnak	A	G	19: 9,009,827	D2825G	possibly damaging	Het
Ahnak	G	A	19: 9,002,143	A264T	probably benign	Het
AI464131	A	G	4: 41,498,577	I351T	probably damaging	Het
Akt1	G	T	12: 112,657,153	T291K	probably damaging	Het
Arhgap24	A	G	5: 102,892,685	D589G	probably damaging	Het
B4galnt3	G	A	6: 120,215,435	Q447*	probably null	Het
BC024063	C	T	10: 82,110,159	R538C	possibly damaging	Het
Bod1l	A	G	5: 41,794,333	S2912P	possibly damaging	Het
Bysl	A	G	17: 47,601,785	V360A	possibly damaging	Het
C1qb	A	G	4: 136,880,566	V162A	possibly damaging	Het
Ccdc57	G	A	11: 120,873,741	P736L	probably benign	Het
Cep290	T	A	10: 100,537,718	F1287I	probably damaging	Het
Cntn1	T	C	15: 92,232,275		probably null	Het
Col6a3	C	T	1: 90,822,291	G274R	probably damaging	Het
Cyb5r4	T	C	9: 87,055,782	C285R	probably damaging	Het
Cyp4f39	G	A	17: 32,489,655	C392Y	probably damaging	Het
Dcun1d3	A	T	7: 119,859,511	D100E	probably damaging	Het
Dhx58	A	T	11: 100,698,171	D516E	probably benign	Het
Dock5	T	A	14: 67,828,502	I351F	probably benign	Het
Elmod2	A	C	8: 83,319,412		probably null	Het
Endov	G	A	11: 119,507,251	A281T	probably benign	Het
Epyc	A	G	10: 97,649,700	M1V	probably null	Het
Espnl	T	A	1: 91,323,568	H128Q	probably damaging	Het
Fam20a	A	T	11: 109,674,628	C452*	probably null	Het
Fam241b	A	G	10: 62,108,954	V88A	probably damaging	Het
Fgd3	A	T	13: 49,296,690	S28T	possibly damaging	Het
Fmn1	C	A	2: 113,525,680	P920Q	unknown	Het
Gpr139	G	C	7: 119,144,866	D165E	probably benign	Het
Hoxb1	A	G	11: 96,367,101	T286A	possibly damaging	Het
Ifi204	T	A	1: 173,759,568	E174D	probably benign	Het
Igf2bp2	A	G	16: 22,061,882	I555T	possibly damaging	Het
Ighv1-85	A	G	12: 116,000,179	I67T	probably damaging	Het
Ihh	G	C	1: 74,951,147	P23R	unknown	Het
Irx2	T	C	13: 72,631,277	S227P	probably damaging	Het
Itga4	A	G	2: 79,256,182	I68V	probably benign	Het
Jsrp1	T	A	10: 80,812,072	T51S	probably benign	Het
Kifc2	G	T	15: 76,662,810	G306V	probably damaging	Het
L3mbtl2	T	A	15: 81,667,387	S85T	possibly damaging	Het
Lama1	T	C	17: 67,767,385	S944P		Het
Lama4	T	A	10: 39,026,635	C202S	probably damaging	Het
Lrrc29	A	G	8: 105,315,667		probably benign	Het
Mkl2	T	A	16: 13,405,854	Y866*	probably null	Het
Morc3	G	A	16: 93,849,173	D218N	probably damaging	Het
N4bp2l1	G	A	5: 150,572,924	T179I	probably damaging	Het
Narf	A	G	11: 121,249,150	E270G	probably benign	Het
Nsd2	A	G	5: 33,892,036	D1205G	probably damaging	Het
Olfr235	T	C	19: 12,268,704	V158A	probably benign	Het
Olfr417	T	C	1: 174,369,193	V92A	probably benign	Het
Parl	T	C	16: 20,287,875	T195A	probably benign	Het
Phrf1	A	G	7: 141,240,933	I158V	unknown	Het
Phtf1	T	C	3: 103,997,664	F543L	possibly damaging	Het
Plod2	T	A	9: 92,584,558	D190E	probably damaging	Het
Ppp2r5a	A	T	1: 191,357,801	I252K	probably damaging	Het
Ptgir	T	A	7: 16,907,048	D88E	probably damaging	Het
Raly	T	C	2: 154,857,420	V48A	probably damaging	Het
Ripor1	T	A	8: 105,617,815	L527*	probably null	Het
Rnf213	T	C	11: 119,416,547	S678P		Het
Rpf1	T	A	3: 146,507,163	Q306L	probably benign	Het
Rpl14	T	C	9: 120,574,105	I122T	probably damaging	Het
Scn9a	C	A	2: 66,484,404	A1657S	possibly damaging	Het
Serpinb10	A	G	1: 107,546,747	Y213C	probably damaging	Het
Slc25a23	A	G	17: 57,052,827	L308P	probably damaging	Het
Smg9	T	A	7: 24,420,633	M387K	probably benign	Het
Socs3	G	A	11: 117,967,788	P148L	probably benign	Het
Susd3	A	G	13: 49,248,430	L14P	probably benign	Het
Syt14	T	A	1: 192,980,550	M80L	probably benign	Het
Tmprss2	T	A	16: 97,568,416	Y386F	possibly damaging	Het
Tmx3	T	A	18: 90,540,071	S416T	probably benign	Het
Treh	A	G	9: 44,685,948	T555A	probably benign	Het
Ttc5	T	G	14: 50,765,943	Q428P	probably damaging	Het
Vmn2r73	A	G	7: 85,871,984	S259P	possibly damaging	Het
Vps4b	A	T	1: 106,791,704	V38E	probably damaging	Het
Wdr83	C	A	8: 85,076,261	R177L	probably benign	Het
Zfp780b	A	G	7: 27,963,163	F656L	possibly damaging	Het
Zfp995	A	T	17: 21,880,660	F198I	probably benign	Het
Zswim8	A	T	14: 20,721,484	Y1495F	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AAAACCACGCCCTCCTTTGG -3'
(R):5'- TTGCATGAAACCAAGGCCTTCC -3'

Sequencing Primer
(F):5'- GCCCTCCTTTGGCTAGAGC -3'
(R):5'- TGAGCTCTTCACAAAGACGGATTC -3'

Posted On

2019-06-26