Incidental Mutation 'R7311:Zfp780b'
ID567583
Institutional Source Beutler Lab
Gene Symbol Zfp780b
Ensembl Gene ENSMUSG00000063047
Gene Namezinc finger protein 780B
SynonymsB230208L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7311 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27959135-27979171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27963163 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 656 (F656L)
Ref Sequence ENSEMBL: ENSMUSP00000146224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081618] [ENSMUST00000205874] [ENSMUST00000206685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081618
AA Change: F656L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080324
Gene: ENSMUSG00000063047
AA Change: F656L

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 171 193 2.91e-2 SMART
ZnF_C2H2 199 221 3.44e-4 SMART
ZnF_C2H2 227 249 3.11e-2 SMART
ZnF_C2H2 255 277 2.4e-3 SMART
ZnF_C2H2 283 305 2.15e-5 SMART
ZnF_C2H2 311 333 1.18e-2 SMART
ZnF_C2H2 339 361 1.47e-3 SMART
ZnF_C2H2 367 389 1.79e-2 SMART
ZnF_C2H2 395 417 2.24e-3 SMART
ZnF_C2H2 423 445 7.9e-4 SMART
ZnF_C2H2 451 473 8.34e-3 SMART
ZnF_C2H2 479 501 7.9e-4 SMART
ZnF_C2H2 507 529 3.16e-3 SMART
ZnF_C2H2 535 557 1.58e-3 SMART
ZnF_C2H2 563 585 9.08e-4 SMART
ZnF_C2H2 591 613 1.36e-2 SMART
ZnF_C2H2 619 641 1.04e-3 SMART
ZnF_C2H2 647 669 1.2e-3 SMART
ZnF_C2H2 675 697 2.24e-3 SMART
ZnF_C2H2 703 725 1.03e-2 SMART
ZnF_C2H2 731 753 4.17e-3 SMART
ZnF_C2H2 759 781 1.78e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205874
Predicted Effect possibly damaging
Transcript: ENSMUST00000206685
AA Change: F656L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,750 V118A probably benign Het
2410089E03Rik G T 15: 8,180,915 V291F probably damaging Het
2810403A07Rik T C 3: 88,711,695 S569P probably damaging Het
Accsl C T 2: 93,865,815 G146D possibly damaging Het
Acsm1 A T 7: 119,638,082 H206L probably damaging Het
Acta2 A G 19: 34,241,786 Y339H probably damaging Het
Adcy2 T C 13: 68,630,954 D989G probably damaging Het
Ahnak G A 19: 9,002,143 A264T probably benign Het
Ahnak A G 19: 9,009,827 D2825G possibly damaging Het
AI464131 A G 4: 41,498,577 I351T probably damaging Het
Akt1 G T 12: 112,657,153 T291K probably damaging Het
Arhgap24 A G 5: 102,892,685 D589G probably damaging Het
B4galnt3 G A 6: 120,215,435 Q447* probably null Het
BC024063 C T 10: 82,110,159 R538C possibly damaging Het
Bod1l A G 5: 41,794,333 S2912P possibly damaging Het
Bysl A G 17: 47,601,785 V360A possibly damaging Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Ccdc57 G A 11: 120,873,741 P736L probably benign Het
Cep290 T A 10: 100,537,718 F1287I probably damaging Het
Cntn1 T C 15: 92,232,275 probably null Het
Col6a3 C T 1: 90,822,291 G274R probably damaging Het
Cyb5r4 T C 9: 87,055,782 C285R probably damaging Het
Cyp4f39 G A 17: 32,489,655 C392Y probably damaging Het
Dcun1d3 A T 7: 119,859,511 D100E probably damaging Het
Dhx58 A T 11: 100,698,171 D516E probably benign Het
Dock5 T A 14: 67,828,502 I351F probably benign Het
Elmod2 A C 8: 83,319,412 probably null Het
Endov G A 11: 119,507,251 A281T probably benign Het
Epyc A G 10: 97,649,700 M1V probably null Het
Espnl T A 1: 91,323,568 H128Q probably damaging Het
Fam20a A T 11: 109,674,628 C452* probably null Het
Fam241b A G 10: 62,108,954 V88A probably damaging Het
Fgd3 A T 13: 49,296,690 S28T possibly damaging Het
Fmn1 C A 2: 113,525,680 P920Q unknown Het
Gpr139 G C 7: 119,144,866 D165E probably benign Het
Hoxb1 A G 11: 96,367,101 T286A possibly damaging Het
Ifi204 T A 1: 173,759,568 E174D probably benign Het
Igf2bp2 A G 16: 22,061,882 I555T possibly damaging Het
Ighv1-85 A G 12: 116,000,179 I67T probably damaging Het
Ihh G C 1: 74,951,147 P23R unknown Het
Irx2 T C 13: 72,631,277 S227P probably damaging Het
Itga4 A G 2: 79,256,182 I68V probably benign Het
Jsrp1 T A 10: 80,812,072 T51S probably benign Het
Kifc2 G T 15: 76,662,810 G306V probably damaging Het
L3mbtl2 T A 15: 81,667,387 S85T possibly damaging Het
Lama1 T C 17: 67,767,385 S944P Het
Lama4 T A 10: 39,026,635 C202S probably damaging Het
Lrrc29 A G 8: 105,315,667 probably benign Het
Mkl2 T A 16: 13,405,854 Y866* probably null Het
Morc3 G A 16: 93,849,173 D218N probably damaging Het
N4bp2l1 G A 5: 150,572,924 T179I probably damaging Het
Narf A G 11: 121,249,150 E270G probably benign Het
Nsd2 A G 5: 33,892,036 D1205G probably damaging Het
Olfr235 T C 19: 12,268,704 V158A probably benign Het
Olfr417 T C 1: 174,369,193 V92A probably benign Het
Parl T C 16: 20,287,875 T195A probably benign Het
Phrf1 A G 7: 141,240,933 I158V unknown Het
Phtf1 T C 3: 103,997,664 F543L possibly damaging Het
Plod2 T A 9: 92,584,558 D190E probably damaging Het
Polr1a G T 6: 71,950,879 K871N possibly damaging Het
Ppp2r5a A T 1: 191,357,801 I252K probably damaging Het
Ptgir T A 7: 16,907,048 D88E probably damaging Het
Raly T C 2: 154,857,420 V48A probably damaging Het
Ripor1 T A 8: 105,617,815 L527* probably null Het
Rnf213 T C 11: 119,416,547 S678P Het
Rpf1 T A 3: 146,507,163 Q306L probably benign Het
Rpl14 T C 9: 120,574,105 I122T probably damaging Het
Scn9a C A 2: 66,484,404 A1657S possibly damaging Het
Serpinb10 A G 1: 107,546,747 Y213C probably damaging Het
Slc25a23 A G 17: 57,052,827 L308P probably damaging Het
Smg9 T A 7: 24,420,633 M387K probably benign Het
Socs3 G A 11: 117,967,788 P148L probably benign Het
Susd3 A G 13: 49,248,430 L14P probably benign Het
Syt14 T A 1: 192,980,550 M80L probably benign Het
Tmprss2 T A 16: 97,568,416 Y386F possibly damaging Het
Tmx3 T A 18: 90,540,071 S416T probably benign Het
Treh A G 9: 44,685,948 T555A probably benign Het
Ttc5 T G 14: 50,765,943 Q428P probably damaging Het
Vmn2r73 A G 7: 85,871,984 S259P possibly damaging Het
Vps4b A T 1: 106,791,704 V38E probably damaging Het
Wdr83 C A 8: 85,076,261 R177L probably benign Het
Zfp995 A T 17: 21,880,660 F198I probably benign Het
Zswim8 A T 14: 20,721,484 Y1495F probably damaging Het
Other mutations in Zfp780b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Zfp780b APN 7 27964761 missense probably benign
IGL03088:Zfp780b APN 7 27962992 missense possibly damaging 0.84
IGL03211:Zfp780b APN 7 27963175 missense possibly damaging 0.93
R0403:Zfp780b UTSW 7 27971689 missense possibly damaging 0.47
R1458:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R1550:Zfp780b UTSW 7 27964857 missense probably benign
R1694:Zfp780b UTSW 7 27964383 missense possibly damaging 0.86
R1823:Zfp780b UTSW 7 27963100 missense possibly damaging 0.93
R2113:Zfp780b UTSW 7 27963873 missense possibly damaging 0.85
R3086:Zfp780b UTSW 7 27963630 missense probably damaging 0.96
R4620:Zfp780b UTSW 7 27962753 nonsense probably null
R5023:Zfp780b UTSW 7 27963448 missense possibly damaging 0.88
R5521:Zfp780b UTSW 7 27974748 splice site probably null
R5582:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R5677:Zfp780b UTSW 7 27962799 missense probably benign 0.33
R5762:Zfp780b UTSW 7 27964818 missense probably benign
R5998:Zfp780b UTSW 7 27964622 missense probably benign 0.07
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6050:Zfp780b UTSW 7 27964302 missense probably damaging 0.98
R6702:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R6703:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R7112:Zfp780b UTSW 7 27963141 missense probably damaging 0.98
R7469:Zfp780b UTSW 7 27963957 missense probably benign 0.02
R7561:Zfp780b UTSW 7 27964612 missense possibly damaging 0.92
R7847:Zfp780b UTSW 7 27964418 missense probably benign 0.00
R7930:Zfp780b UTSW 7 27964418 missense probably benign 0.00
X0024:Zfp780b UTSW 7 27963250 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCCTTTCCACACTCCTG -3'
(R):5'- CAAGTGTAAGCTCTGTGGGTCAG -3'

Sequencing Primer
(F):5'- CTGACACTTAAACGGTTTCTCATCAG -3'
(R):5'- GGGTCAGCCTTCAGACGTAAGTAC -3'
Posted On2019-06-26